flowjo alternatives  - Free Activators

The activation status of peritoneal macrophages (PMs) derived from granulosus (sensu stricto) promotes the alternative activation of. A dongle is a small security device that plugs into your computer. It acts like a mobile serial number for FlowJo, allowing users to run FlowJo on any number of. Download NOW FlowJo 10.8 Crack + Serial Key Free Download 2021 FlowJo 10.8 Crack files consolidate numerous documents into a solitary record.

watch the video

Free Alternatives for Kickstart and LFO Tool - #Shorts

Alternative splicing of MALT1 controls signalling and activation of CD4+ T cells

Abstract

MALT1 channels proximal T-cell receptor (TCR) signalling to downstream signalling pathways. With MALT1A and MALT1B two conserved splice variants exist and we demonstrate here that MALT1 alternative splicing supports optimal T-cell activation. Inclusion of exon7 in MALT1A facilitates the recruitment of TRAF6, which augments MALT1 scaffolding function, but not protease activity. Naive CD4+ T cells express almost exclusively MALT1B and MALT1A expression is induced by TCR stimulation. We identify hnRNP U as a suppressor of exon7 inclusion. Whereas selective depletion of MALT1A impairs T-cell signalling and activation, downregulation of hnRNP U enhances MALT1A expression and T-cell activation. Thus, TCR-induced alternative splicing augments MALT1 scaffolding to enhance downstream signalling and to promote optimal T-cell activation.

Introduction

Antigenic stimulation of the T-cell receptor (TCR) together with a CD28 co-stimulatory receptor induces productive activation of naive CD4+ T cells. MALT1 (mucosa-associated lymphoid tissue protein 1) bridges TCR/CD28 co-engagement to cellular downstream signalling pathways to promote T-cell activation and effector functions1,2. As part of the CARMA1–BCL10–MALT1 (CBM) signalling complex, MALT1 channels upstream TCR signalling to the canonical IκB kinase (IKK)/nuclear factor-κB (NF-κB) signalling pathway. Three TRAF6-binding sites have been mapped on MALT1 (refs 3, 4). MALT1 recruits TRAF6 to the CBM complex to promote MALT1 ubiquitination and to facilitate activation of the IKK complex5. Besides its scaffolding function, MALT1 contains a paracaspase domain, and MALT1 proteolytic activity is induced on antigen stimulation in T cells6,7. MALT1 proteolytic activity is not directly involved in controlling canonical NF-κB signalling7,8. However, MALT1 cleavage of the deubiquitinases A20 and CYLD, the E3 ligase HOIL, the non-canonical NF-κB family member RelB or the RNA regulators Regnase-1 and Roquin have been associated with various functions for T-cell biology6,7,9,10,11,12,13.

Alternative splicing is a crucial and ubiquitous mechanism that controls gene expression at the co- and post-transcriptional level. In mammals, most pre-mRNAs avast internet security vs premier - Crack Key For U prone to alternative splicing, which results in the generation of multiple transcripts and proteins with diverse functions. Extensive changes in splicing patterns have been shown to occur in the immune response and especially in antigen-dependent T-cell activation14. Alternative splicing can act on multiple layers ranging from cell surface receptors, cytokines, signalling proteins to transcription factors, and thereby constitutes an essential regulatory mechanism for T-cell function15,16. A well-studied example is the TCR-induced exon exclusion of the transmembrane phosphatase CD45, which creates a negative-feedback regulation that counteracts T-cell activation17,18. However, in T cells, little is known how alternative splicing modulates expression and activity of intracellular signalling mediators and how this can influence T-cell signalling and activation.

Two conserved alternative splice isoforms of MALT1 have been assigned that differ only by inclusion (MALT1A) or exclusion (MALT1B) of exon7 that codes for 11 amino acids (aa 309–319 of human MALT1). However, neither expression nor functions of the two MALT1 alternative splice variants have been investigated. Here we identify heterogeneous nuclear ribonucleoprotein U (hnRNP U; SAF-A/SP120) as a factor that controls alternative MALT1 splicing and demonstrate that TCR-induced splicing of MALT1 increases relative MALT1A expression, which augments MALT1 scaffolding function and fosters activation of CD4+T cells.

Results

MALT1 exon7 supports optimal T-cell signalling and activation

A comparison of mammalian transcriptome databases revealed that MALT1 is expressed in two alternative splice isoforms (Fig. 1a). The mRNA of the splice variants MALT1A (824 aa) and MALT1B (813 aa) only differs in the inclusion or exclusion of the 33-bp long exon7, which codes for amino acids 309–319 positioned between the Ig2- and caspase-like domains of human MALT1. The region was shown to contain a putative TRAF6-binding motif4. Expression of both splice variants, exon/intron boundaries, amino-acid sequences and TRAF6-binding site in MALT1 exon7 are highly conserved in mammals (Fig. 1a). This evolutionary and structural conservation points to a functional relevance of preserving the expression of the two MALT1 variants.

(a) Domain structure of MALT1 isoforms with different TRAF6-binding motifs (T6BMs) highlighted in orange and blue. Sequence conservation of T6BM1 in exon7 in different species is shown below. Protein domains are denoted by black boxes. DD, death domain, Ig, Immunoglobulin-like domain. (b) Schematics of the T6BMs in MALT1A and MALT1B. Different TRAF6-binding mutants were generated by glutamate (E) to alanine point mutations (A) as indicated. (ch) MALT1-deficient Jurkat T-cell clone was reconstituted with StrepTagII (mock) or MALT1-StrepTagII variants. (c) MALT1 expression was checked by western blot (WB). (d) Reconstituted cells were stimulated with P/I for the indicated time points. NF-κB signalling was analysed by electrophoretic mobility shift assay (EMSA) and WB, and NF-κB signal was quantified relative to OCT1 control. (e,f) Cells transduced with MALT1A wild-type or MALT1A mutants were stimulated with P/I for the indicated time points. NF-κB and MAPK signalling were analysed by WB and EMSA. (g) CBM complex formation as well as TRAF6 recruitment were investigated by StrepT-PD after 30 min P/I stimulation. Binding of MALT1 to NEMO was monitored after NEMO IP. Modified MALT1 indicative of ubiquitination is marked by asterisk (*). (h) Proteins were precipitated by StrepT-PD after 20 min P/I stimulation and active MALT1 was detected using fluorescent MALT1-ABP probe. Data are representative of at least three independent experiments.

Full size image

Two functional TRAF6-binding motifs (T6BM2 and T6BM3) have been identified in the C terminus of MALT1 (ref. 3; Fig. 1b). TRAF6 binding to T6BM1 within exon7 was demonstrated, but the role for T-cell signalling has not been investigated4. To analyse the putative isoform-specific effects on T-cell signalling, we generated MALT1-deficient Jurkat T cells using CRISPR/Cas9 for viral reconstitution (Supplementary Fig. 1a). The absence of MALT1 protein was verified by western blotting (Supplementary Fig. 1b). As expected, NF-κB activation in response to PMA/Ionomycin (P/I), but not tumour necrosis factor-α (TNF-α) stimulation, was lost in Jurkat T-cell clone #2 that lacks MALT1 (Supplementary Fig. 1c). To analyse the differential effects of MALT1 isoforms, MALT1-deficient Jurkat T cells were lentivirally reconstituted with MALT1A or MALT1B. Both the isoforms were expressed at equivalent levels and in the range of endogenous MALT1 from Jurkat T cells (Fig. 1c). Reconstitution with either MALT1A or MALT1B rescued NF-κB signalling, but the activation of IκBα degradation and NF-κB in MALT1A-expressing cells was more rapid and slightly stronger when compared with MALT1B cells (Fig. 1d), indicating that inclusion of exon7 can facilitate TRAF6 recruitment to promote optimal NF-κB activation.

We wanted to validate that the putative binding motif in MALT1 exon7 is crucial for signalling in Jurkat T cells. For this, we reconstituted MALT1-deficient Jurkat T cells with MALT1A or MALT1B constructs mutated in one or more TRAF6-binding sites (Fig. 1b; Supplementary Fig. 1d). Whereas mutation of the TRAF6-binding motif 2 (T6BM2) next to the Ig3 in MALT1B does not affect signalling, activation of NF-κB, JNK and p38 completely relies on the presence of the most C-terminal T6BM3 (Supplementary Fig. 1e,f). In contrast, only the combined mutation of T6BM1 in exon7 and the C-terminal T6BM3 (T6BM1/3 EA) in MALT1A abrogates the activation of downstream signalling pathways (Fig. 1e,f). To prove that the mutations in individual or multiple T6BMs affect TRAF6 recruitment, we performed StrepT-PD of transduced Jurkat T cells (Fig. 1g). Constitutive BCL10 association and inducible CARMA1 recruitment were not affected by MALT1 exon7 inclusion or mutations of TRAF6 sites, but TRAF6 recruitment was diminished in MALT1B compared with MALT1A. In line with the effects on signalling, mutation of the binding site T6BM3 in MALT1B alone and the combined mutation of T6BM1/3 in MALT1A abolished TRAF6 recruitment. Also, MALT1 ubiquitin modification was severely reduced only in the absences of any functional TRAF6-binding site, which prevented recruitment of ubiquitinated MALT1 to the IKK regulatory subunit NEMO (Fig. 1g)5. Thus, the mutagenesis of individual or multiple TRAF6-binding sites confirms that exon7 is significantly contributing to the activation of downstream signalling pathways.

To test whether splicing affects MALT1 proteolytic activity in response to T-cell stimulation, we measured MALT1 protease activation in reconstituted Jurkat T cells using fluorescently labelled MALT1 activity-based probe (MALT1-ABP; Fig. 1h)19. As expected, MALT1 activation was detected on P/I stimulation and active MALT1 was heavily modified, which most likely corresponds to previously described active MALT1 ubiquitin conjugates20. However, MALT1A and MALT1B were activated to a similar extent and also cleavage of the MALT1 substrate CYLD was not altered in MALT1A- or MALT1B-expressing cells (Supplementary Fig. 1g), revealing that MALT1 protease activation is not affected by inclusion or exclusion of exon7.

To test whether the MALT1 splice variants exert differential effects on CBM downstream signalling in primary T cells, we purified CD4+ T cells from Malt1−/− mice and reconstituted the cells by retroviral transduction with either MALT1A or MALT1B. Reconstituted T cells were expanded and transduced cells were purified by the co-expressed surface marker Thy1.1 yielding 80–90% Thy1.1-positive T cells (Supplementary Fig. 2a). As expected, the absence of MALT1 completely abolished NF-κB and JNK signalling on T-cell stimulation (Supplementary Fig. 2b)1. Expression of MALT1A and MALT1B was comparable to endogenous MALT1 levels in T cells from wt mice (Fig. 2a). To determine induction of NF-κB and MAPK signalling, reconstituted T cells were restimulated with anti-CD3/CD28 or P/I (Fig. 2b,c; Supplementary Fig. 2c,d). Expression of both the MALT1 isoforms rescued NF-κB signalling on anti-CD3/CD28 or P/I stimulation. Congruent with our observations in MALT1-deficient Jurkat T cells, IκBα degradation was more rapid and NF-κB activation was stronger in cells expressing MALT1A when compared with MALT1B. Also, JNK phosphorylation was rescued on MALT1 expression and MALT1A was more potent in mediating JNK activation than MALT1B after anti-CD3/CD28 or P/I stimulation. MALT1 was also able to rescue the partial defect in p38 activation that has been observed earlier in MALT1-deficient T cells1, but p38 activation did not rely on the MALT1 isoforms. Moreover, despite a reduction in ERK amounts in MALT1A- or MALT1B-expressing cells, no differences in the extent of inducible ERK phosphorylation were detected using the two splice variants.

(ac) CD4+ T cells from MALT1-deficient mice (C57BL/6J) were reconstituted with mock, MALT1A or MALT1B. (a) MALT1 expression levels of T cells from wt mice or reconstituted Malt1−/− mice were determined by western blot (WB). NF-κB (b) and MAPK signalling (c) were analysed by WB after stimulation with anti-CD3/CD28 as indicated. NF-κB DNA binding was determined by electrophoretic mobility shift assay (EMSA). NF-κB signal was quantified relative to OCT1 control. (d,e) MALT1-deficient mice (C57BL/6J) were reconstituted with MALT1A, MALT1B or different TRAF6-binding mutants as indicated (Fig. 1b). IκBα phosphorylation and degradation were analysed by WB after P/I stimulation and DNA binding of NF-κB was monitored by EMSA. NF-κB signal was quantified relative to OCT1 control. Data are representative of at least three independent experiments.

Full size image

To investigate whether the TRAF6-binding motifs in the C terminus and exon7 contribute to differential effects on MALT1 downstream signalling in primary T cells, we performed reconstitutions using a series of MALT1 point mutations to destroy T6BMs individually or in combination (Fig. 1b) and determined the effects on NF-κB signalling in primary T cells. Mutation of the C-terminal TRAF6 motifs (T6BM2/3 EA) in MALT1A led to a similar reduction in P/I-triggered NF-κB signalling activation as exclusion of exon7 in MALT1B (Fig. 2d). Moreover, NF-κB signalling was decreased on destruction of the T6BM1 in exon7 MALT1A (T6BM1 EA; Fig. 2e). Only the combined destruction of T6BMs in either MALT1A (T6BM1/2/3 EA) or MALT1B (T6BM2/3 EA) completely abolished the NF-κB response (Fig. 2d,e). Thus, in primary T cells, intact TRAF6-binding sites in the C terminus of MALT1B are sufficient to induce moderate downstream signalling, but cooperation between C-terminal and exon7-encoded TRAF6-binding motifs promote optimal NF-κB signalling.

In Jurkat T cells, we observed the effects of exon7 on downstream signalling, but not on paracaspase activity, suggesting that inclusion of exon7 is primarily modulating MALT1 scaffolding function. Interleukin (IL)-2 expression critically depends on MALT1 scaffolding and partially on MALT1 cleavage activity5,8,21,22,23. Indeed, IL-2 production after anti-CD3/CD28 stimulation was rescued in T cells retrovirally reconstituted with MALT1A or MALT1B, but the number of IL-2-producing cells was increased in MALT1A transduced cells (Fig. 3a,b). Therefore, the stronger potency of MALT1A to promote downstream signalling correlates with a more robust IL-2 production. TH17 differentiation was completely abolished in MALT1 protease defective mice and is thus apparently independent of MALT1 scaffolding function22,24. To investigate whether inclusion of exon7 influences TH17 differentiation, we adenovirally transduced naive CD4+ T cells expressing a signalling-deficient coxsackie adenovirus receptor (CARΔ1) from Malt1−/−R26/CAG-CARΔ1stop-flCd4-Cre mice12,25 using green fluorescent protein (GFP) as infection marker (Supplementary Fig. 3a). We optimized ex vivo differentiation under TH1- or TH17-inducing conditions and found that TH17 differentiation was absent in Malt1−/− T cells in the presence of anti-CD3 and irradiated antigen-presenting cells (APCs; Supplementary Fig. 3b). Interestingly, also TH1 differentiation was diminished in the absence of MALT1, indicating that depending on the conditions MALT1 does not only control TH17 differentiation24. Using these conditions, we monitored the number of IFNγ-producing TH1 cells and IL-17A-expressing TH17 cells in MALT1-deficient cells after viral rescue (Fig. 3c,d). Both the MALT1 splice variants induced TH17 and TH1 differentiation to a similar extend. In contrast, the catalytically inactive MALT1A C464A mutant was unable to promote TH1 and TH17 differentiation. Thus, the biochemical and functional data provide evidence that alternative MALT1 splicing modulates MALT1 scaffolding and downstream signalling, but does not affect MALT1 protease activity and cell fate decisions.

(a,b) Malt1−/− CD4+ T cells were retrovirally reconstituted with either mock, MALT1A or MALT1B. (a) Reconstituted T cells were stimulated with anti-CD3/CD28 for 4 h and intracellular IL-2 production was analysed by FACS. (b) Quantification of IL-2 production. The percentage of IL-2-positive cells from MALT1B-expressing cells was set to 1. Depicted is the mean±s.d. (n=3) (c,d) CD4+ T cells from Malt1−/−R26/CAG-CARΔ1stop-flCd4-Cre mice were adenovirally reconstituted with GFP control, MALT1A, MALT1B or MALT1A C464A. Cells were cultured for 3 days under TH1- or TH17-polarizing conditions and restimulated with P/I. GFP+ cells were analysed for intracellular IFN-γ and IL-17A levels by FACS and numbers in quadrants represent percentage of IFN-γ- or IL-17A-positive cells. (d) Data show mean±s.d. (n=4). *P<0.05; **P<0.01; NS, not significant; unpaired t-test.

Full size image

TCR signalling upregulates MALT1A in CD4+ T cells

To elucidate whether the differences in MALT1 signalling strength observed on inclusion or skipping of exon7 are relevant for activation of CD4+ T cells, we next investigated the expression of MALT1 splice variants on RNA level. We designed primer pairs that either flank exon7 (ex6–ex9/10) to amplify MALT1A/B simultaneously or exon spanning primers that selectively amplify either MALT1A (ex5–ex7/8) or MALT1B (ex5–ex6/8; Fig. 4a,b; Supplementary Fig. 4a). Semi-quantitative PCR (qPCR) demonstrated that MALT1A and MALT1B are expressed at equivalent levels in Jurkat T cells, but differentially expressed in murine tissues (Fig. 4b). Whereas MALT1A and MALT1B were present in murine brain and liver, the lymphoid organs spleen and thymus contained almost exclusively the shorter MALT1B variant, indicating that MALT1 is prone to alternative splicing in different cells and tissues. To better compare MALT1 isoform expression, we amplified either MALT1A or MALT1B by qPCR. In murine CD4+ T cells, MALT1B transcripts were more abundant and expressed ∼100-fold more than MALT1A mRNA, which was hardly detectable (Fig. 4c). Next, we analysed the changes in mRNA expression of the two MALT1 isoforms after TCR/CD28 stimulation by semi-qPCR or qPCR (Fig. 4d–f). Again, MALT1A transcripts in CD4+ T cells purified from spleen or thymus were almost undetectable, but MALT1A was induced by a factor of 10–12 on anti-CD3/CD28 or anti-CD3 stimulation. P/I stimulation was not sufficient to induce MALT1A, suggesting that proximal TCR signalling events are critical. MALT1B levels were only moderately induced (2–4-fold) on anti-CD3 or anti-CD3/CD28 ligation, which was also seen for overall MALT1 expression (Supplementary Fig. 4b). Induction of MALT1A, but not MALT1B expression, was also observed on stimulation of primary OT-II T cells with the ovalbumin (OVA) peptide-loaded APCs (Fig. 4g). Thus, TCR ligation induces alternative MALT1 splicing and inclusion of exon7. Despite the higher expression of MALT1B, TCR signalling triggers a relative increase of MALT1A transcript levels in CD4+ T cells.

(a) Scheme of MALT1 primers amplifying MALT1A (ex5–ex7/8), MALT1B (ex5–ex6/8) or MALT1A/B (ex6–ex9/10 or ex16–ex17). (b) Analysis of MALT1 mRNA levels by RT–PCR in Jurkat T cells and different murine tissues from BALB/c mice using ex6–ex9/10 primers amplifying both isoforms. GAPDH served as control. (cf) MALT1A and MALT1B mRNA levels in CD4+ T cells from BALB/c mice were investigated by qPCR (c,f) or semi-qPCR (d,e) using isoform-specific ex5–ex7/8 or ex5–ex6/8 primers. Transcript levels were normalized to Hydroxymethylbilane Synthase (HMBS) mRNA levels. For semi-qPCR, amplification cycles were adjusted for MALT1A (35 cycles) and MALT1B (28 cycles). (g) MALT1A and MALT1B mRNA levels were analysed in OT-II CD4+ T cells cultured for 6 h alone or with irradiated wild-type APCs unloaded or loaded with 1 μg ml−1 OVA peptide. HMBS served as internal control and relative induction was determined comparative to unloaded APCs cultured with OT-II T cells. (h) Activated CD62LCD44+ effector memory T cells, naive CD62L+CD44 T cells and CXCR5+PD1+ T-follicular helper (TFH) cells were sorted from immunized BALB/c mice. RNA was isolated, and MALT1A and MALT1B levels were analysed by semi-qPCR using isoform-specific primer pairs. (i) CD4+ T cells from BALB/c and C57BL/6J mice were treated with anti-CD3, anti-CD28 or both stimuli. After lysis, MALT1A was precipitated using anti-MALT1A antibody. A pan-MALT1 antibody was used for detection by western blot (WB). (j) Primary human CD4+ T cells from four donors were stimulated with anti-CD3/CD28 for 3 h. MALT1A and MALT1B mRNA levels were measured by qPCR using human MALT1A- or MALT1B-specific primers. RP2 served as internal control and relative induction was determined comparative to unstimulated cells. Data are representative for two (b,d) or three (c,ei) or four (j) independent experiments. Depicted is the mean±s.d. (c,ei; n=3) or (j; n=4). *P<0.05; **P<0.01; ***P<0.001; NS, not significant; unpaired t-test.

Full size image

To confirm that the induction of MALT1A was also seen in vivo, BALB/c mice were immunized by intravenous injection of sheep erythrocytes. After 7 days, naive T cells (CD62L+CD44), activated effector Oxygen XML Editor Free Activate T cells (CD62L-CD44+) and T-follicular helper cells (TFH; CXCR5+PD1+) were purified. Whereas MALT1B transcripts were not changed in the three T-cell subsets, the MALT1A splice variant was highly expressed in activated T cells and TFH cells, but low in naive T cells (Fig. 4h). Thus, alternative MALT1 splicing is also induced in vivo, leading to a MALT1A upregulation in activated CD4+ T-cell subsets.

To address whether TCR-induced alternative splicing and exon7 inclusion also enhanced MALT1A protein amounts, we generated a rabbit polyclonal antibody against exon7 (aa 309–316), which is identical in human and murine MALT1A. On overexpression of MALT1, the antibody recognized exclusively Flag-MALT1A in western blots or after immunoprecipitation (IP) and did not cross-react with Flag-MALT1B (Supplementary Fig. 4c). To detect endogenous MALT1A, we had to enrich MALT1A by IP and used the higher affinity pan-MALT1 antibody for immunoblot detection (Fig. 4i). MALT1A protein was hardly detectable in CD4+ T cells, but anti-CD3/CD28 stimulation induced MALT1A expression in T cells from different mouse strains. Again, anti-CD3 stimulation alone was able to induce MALT1A expression. Owing to the high MALT1B expression levels, total MALT1 protein expression was largely unchanged after stimulation and we only observed a modest upregulation in C57BL/6 mice. Taken together, the results demonstrate that TCR ligation leads to an alteration in the MALT1 isoform ratio and an increase in the relative amounts of MALT1A in activated T cells.

Since MALT1 exon7 is conserved in mammals, we asked whether differences in MALT1A and MALT1B levels are also seen in human T cells purified from peripheral blood. Human CD4+ T cells expressed more MALT1B mRNA compared with MALT1A (Fig. 4j). Again, anti-CD3/CD28 stimulation induced a relative increase in MALT1A expression. Even though the effects were not as pronounced as in splenic murine CD4+ T cells, the data reveal that MALT1 is prone to alternative splicing in human T cells.

hnRNP U negatively regulates inclusion of MALT1 exon7

To corroborate our findings that MALT1 is prone to alternative splicing, we searched for RNA-binding proteins that influence the relative expression of MALT1A and MALT1B. Since both the MALT1 isoforms are expressed constitutively in Jurkat T cells (Fig. 4a), we initiated two independent small interfering RNA (siRNA) screens after transfection of smart pool siRNA against putative RNA-binding proteins that have been connected to splicing. We determined relative expression of MALT1A and MALT1B either by qPCR (Fig. 5a) or radioactive PCR (Supplementary Fig. 5a; Supplementary Table 1). In both data sets, we identified the splice factor hnRNP U as a candidate that induced the most robust inclusion of MALT1 exon7 and thus the strongest shift towards the MALT1A expression. Knockdown of hnRNP U by the smart pool siRNA was verified by qPCR and MALT1 exon7 inclusion was also evident by semi-qPCR (Supplementary Fig. 5b,c). Next, we confirmed the relative increase in the expression levels of MALT1A versus MALT1B using three independent siRNAs (Fig. 5b,c). Thus, RNA interference identified hnRNP U as a negative regulator of exon7 inclusion in Jurkat T cells.

(a) Identification of RNA-binding proteins involved in MALT1 splicing by RNA interference. Jurkat T cells were transfected with smart pool siRNA against the depicted proteins and the ratio MALT1A/B mRNA was analysed by qPCR. (b) Knockdown of hnRNP U after transfection of three independent siRNAs in Jurkat T cells. (c) qPCR of MALT1A and MALT1B mRNA after downregulation of hnRNP U in Jurkat T cells. Shown is the MALT1A/B mRNA ratio. (d) Binding of hnRNP U to MALT1 pre-mRNA. IgG control IP or anti-hnRNP U IP was carried out from extracts of si-control- or si-hnRNP U-transfected Jurkat T cells. IP of MALT1 pre-mRNA was detected by qPCR using primers amplifying the depicted fragments. Primers amplifying MALT1 pre-mRNA in1–ex2 served as negative control. (e) Exon7 spanning minigenes M1 and M2 were transfected into Jurkat T cells together with si-control or si-hnRNP U. Transcript levels of the minigene with or without exon7 were analysed by RT–PCR. (f) hnRNP U knockdown on mRNA level in CD4+ T cells after transduction of either control or two hnRNP U adenoviruses. hnRNP U levels were analysed by qPCR using sorted GFP+ CD4+ T cells after 6 h anti-CD3/CD28 stimulation. (g) Analysis of MALT1A and MALT1B transcript levels after 6 h anti-CD3/CD28 stimulation of either control or sh-hnRNP U-transduced cells. All qPCR were performed using HMBS as internal control. Data are representative for two (a,d) or three (b,c,eg) independent experiments. Depicted is the mean±s.d. (a,d; n=2) or (c,f,g; n=3). *P<0.05; **P<0.01; ***P<0.001; NS, not significant; unpaired t-test.

Full size image

To validate the impact of hnRNP U, we investigated binding of hnRNP U to the MALT1 pre-mRNA. RNA-binding protein IP (RIP) was performed with anti-hnRNP U or IgG control antibodies in Jurkat T cells and the MALT1 pre-mRNA near exon7 (between exon6 FL Studio 20.8.3.2304 Crack With Activation Code Free 2021 exon9) or in a more distant region (exon2) was amplified by qPCR (Fig. 5d). The pre-mRNA of MALT1 in the region of exon7 was enriched on hnRNP U RIP and highest values were obtained for the fragments in proximity or covering exon7. Specificity was confirmed by hnRNP U knockdown and amplification of an in1–ex2 fragment, which was not enriched after hnRNP U RIP. hnRNP U association to MALT1 pre-mRNA was also seen in semi-qPCR using in6/ex7–in7 primers (Supplementary Fig. 5d). To address whether cis-regulatory sequences around exon7 are able to control skipping or inclusion, we constructed a minigene bearing exon7 and flanking intronic sequences cloned between constitutive exon3 and 7 of CD45. Whereas Jurkat T cells transfected with the longer construct M2 resulted in equivalent exon7 skipping/inclusion, exon7 was almost completely excluded using the shorter fragment M1 (Fig. 5e). hnRNP U induced exon7 exclusion in both minigenes confirming its role as a negative regulator of exon7 splicing. Thus, our data reveal that enhancer and silencer regions in the vicinity to exon7 control alternative MALT1 splicing and that binding of hnRNP U impairs exon7 inclusion.

To determine whether hnRNP U is also controlling MALT1A transcript levels on TCR stimulation in primary T cells, we used adenoviral small hairpin RNA (shRNA) knockdown in murine CD4+ T cells. Infected CD4+ T cells were sorted based on co-expression of GFP and an efficient downregulation of hnRNP U was obtained with two independent shRNAs (Fig. 5f; Supplementary Fig. 5e). Indeed, increased MALT1A expression after anti-CD3 stimulation was detected after downregulation of hnRNP U (Fig. 5g). In contrast, MALT1B expression was not altered. We asked whether enhanced MALT1A expression might be correlated with a decrease in hnRNP U after T-cell activation. However, on RNA level, the MALT1A suppressor hnRNP U was induced, but at the same time other splicing factors that enhanced MALT1A in the screens (for example, hnRNP R, SRSF3 and SRSF9) were increased (Supplementary Fig. 5f). Thus, TCR-induced alternative splicing of exon7 and the relative expression of MALT1A/B transcripts in CD4+ T cells is regulated by hnRNP U, but alternative MALT1 splicing seems to be regulated by a complex network of negatively and positively acting splice factors.

MALT1A supports and hnRNP U counteracts T-cell activation

To test a potential influence of alternative MALT1 splicing on cellular signalling in T cells, we designed a morpholino oligomer (MO) targeting the exon7–intron7 boundary of the MALT1 pre-mRNA to selectively prevent alternative inclusion of exon7 and thus MALT1A expression (Fig. 6a). MALT1A MO (AMO) suppressed MALT1A mRNA and protein expression in mouse embryonic fibroblasts (MEFs; Supplementary Fig. 6a,b). Also, in murine T cells, AMO treatment abolished anti-CD3- or anti-CD3/CD28-stimulated induction of MALT1A transcripts without affecting transcript levels of MALT1B (Fig. 6b,c; Supplementary Fig. 6c).

(a) Scheme for vivo morpholino (MO)-induced disruption of MALT1A expression. MO is designed to bind the 3′-splice site of exon7/intron7 in MALT1 pre-mRNA to prevent spliceosomal recognition. (b,c) CD4+ T cells from BALB/c mice were adguard 3.1.0 premium apk - Free Activators with morpholino against MALT1A (AMO), control MO (cMO) or kept untreated for 18 h before anti-CD3 or anti-CD3/CD28 stimulation for 6 h. MALT1 mRNA levels were analysed by qPCR using isoform-specific primers. HMBS served as internal control and relative induction was determined by comparing stimulated to unstimulated cells. (d,e) CD4+ T cells from BALB/c mice were pretreated with anti-CD3 for 4 h and afterwards stimulated with P/I for the indicated times. Phosphorylation and degradation of IκBα (d) as well as MAPK activation (e) were analysed by WB. Electrophoretic mobility shift assay (EMSA) was used to detect DNA binding of NF-κB (d). (fh) Untreated, AMO- or cMO-treated CD4+ T cells were pretreated with anti-CD3 (4 h) before stimulation with P/I. (f,g) NF-κB and MAPK signalling were analysed by EMSA and WB. NF-κB signal was quantified relative to OCT1 control. (h) CYLD cleavage was monitored by WB. Data are representative of two (h) or three independent experiments (bg). In b and c, the mean±s.d. (n=3) is depicted.

Full size image

Since freshly isolated CD4+ T cells lack considerable MALT1A expression, no changes in NF-κB signalling and JNK activation were observed in AMO-treated cells stimulated with anti-CD3/CD28 or P/I (Supplementary Fig. 6d,e). To test whether induction of MALT1A on TCR ligation can augment T-cell signalling, we pretreated CD4+ T cells with anti-CD3 to induce MALT1A expression and restimulated the cells with P/I, taking advantage of the fact that P/I bypasses upstream TCR stimulation that may be altered due to the prestimulation. NF-κB was enhanced after 4 h TCR prestimulation, and the activation of NF-κB and JNK was augmented on secondary P/I restimulation, while the activities of ERK and p38 were unaffected in these experimental conditions (Fig. 6d,e). To test whether MALT1A induction is required to augment NF-κB and JNK signalling on restimulation, we cultured the purified CD4+ T cells in the presence of AMO during anti-CD3 pretreatment to prevent MALT1A induction (Fig. 6b). Again, TCR stimulation augmented NF-κB activation and slightly enhanced JNK phosphorylation on secondary P/I stimulation in untreated or in cMO-treated T cells (Fig. 6f,g). In contrast, inhibition of MALT1A by AMO severely reduced NF-κB activation and mildly impaired JNK signalling. Both the pathways are activated after AMO treatment to a similar degree as in CD4+ T cells without prestimulation. Again, ERK and p38 activation were not affected, revealing that MALT1A induction is selectively affecting NF-κB and JNK signalling. Since JNK activation in Jurkat T cells has been linked to CYLD cleavage by MALT1 paracaspase10, we checked for changes in MALT1 paracaspase activity and CYLD cleavage in primary T cells depending on the induction of MALT1A (Fig. 6h; Supplementary Fig. 6f). Inhibition of MALT1A induction did not alter MALT1 protease activation. CYLD cleavage was reduced after anti-CD3 pretreatment, but morpholino treatment did not alter CYLD cleavage after P/I restimulation, revealing that augmented JNK signalling is not caused by enhanced MALT1 activity.

In Malt1−/− T cells, expression of MALT1A promoted a more robust T-cell signalling and IL-2 production when compared with MALT1B (Figs 2 and 3). To test whether MALT1A induction is also required for robust T-cell activation, AMO- and cMO-treated CD4+ T cells were stimulated with anti-CD3/CD28 for 6 h and surface expression of activation markers CD25 and CD69 as well as induction of IL-2 were examined. Indeed, prevention of MALT1A induction led to reduced surface expression of CD69 and CD25 (Fig. 7a,b). Further, induction of IL-2 mRNA as well as the number of IL-2-expressing cells were decreased in AMO-treated CD4+ T cells (Fig. 7c-e), reflecting that TCR-triggered induction of MALT1A is necessary to promote optimal T-cell activation.

(ae) CD4+ T cells from BALB/c mice were left untreated or were treated with AMO or cMO before stimulation. (a) Cell surface expression of CD69 and CD25 was determined by FACS after 6 h of anti-CD3/CD28 stimulation. (b) Mean fluorescence intensity (MFI) values of CD25 and CD69 after stimulation of MO-treated cells. (c) Induction of IL-2 mRNA in CD4+ T cell (no MO, AMO or cMO treated) after anti-CD3/CD28 stimulation was determined by qPCR. (d) Intracellular IL-2 staining after anti-CD3/CD28 and different MO treatments was analysed by FACS. (e) Number of IL-2-positive cells as gated in d was quantified in relation to stimulated control cells (no MO). (fj) CD4+ T cells from R26/CAG-CARΔ1stop-flCd4-Cre mice were transduced with control or sh-hnRNP U adenoviruses and stimulated with anti-CD3/CD28. (f) Cells gated for GFPlow and GFPhigh expression (left) were analysed for CD25 and CD69 surface expression (right). (g,h) CD25 and CD69 MFI values after stimulation of adenoviral-transduced cells. MFI was directly compared between GFPlow (no hnRNP U knockdown)- and GFPhigh (hnRNP U knockdown)-expressing cells. (i) Relative IL-2 mRNA levels in sorted GFP+ CD4+ T cell on adenoviral transduction of control or sh-hnRNP U #1 after anti-CD3/CD28 stimulation was determined by qPCR. (j) Intracellular IL-2 levels after anti-CD3/CD28 stimulation in sorted GFP+ cells was analysed by FACS. Histograms and dot blots show representatives of two (j) or three (ai) independent experiments. (b,c,e,gi) Depicted is the mean±s.d. (n=3). *P<0.05; **P<0.01; ***P<0.001; NS, not significant; unpaired t-test.

Full size image

To provide evidence that alternative splicing and MALT1A induction is involved in augmented T-cell activation, we determined the effects of knocking down the splicing factor hnRNP U that counteracts inducible MALT1A production in CD4+ T cells (Fig. 5g). Indeed, CD25 surface expression was significantly enhanced in GFP+ cells containing the adenoviral hnRNP U shRNA, but Minitab 20.2.2021 Crack + Product Key Full Version Download Free in the GFP cells (Fig. 7f–h). The weaker differences in CD69 upregulation after hnRNP U knockdown is most likely due to the rapid localization of intracellular CD69 at the cell surface on T-cell activation26. We sorted GFP expressing CD4+ T cells to determine IL-2 expression on mRNA and protein level. Again, sh-hnRNP U augmented IL-2 induction and enhanced the number of IL-2-expressing cells (Fig. 7i,j). Taken together, prevention or enhancement of MALT1A induction by morpholinos or sh-hnRNP U, respectively, exerted opposing effects on T cell activation, suggesting that MALT1 alternative splicing controls relative MALT1A and MALT1B levels and thus functions as a molecular switch to tune T-cell activation.

Discussion

MALT1 paracaspase controls adaptive and innate immune signalling pathways and is a key regulator of T-cell activation27. Despite the fact that two conserved MALT1 splice variants exist in mammals neither expression nor the functional relevance of these MALT1 isoforms has been explored. Here we show that MALT1 is prone to alternative splicing. While murine CD4+ T cells express almost exclusively the shorter isoform MALT1B, the longer exon7 containing variant MALT1A is induced on TCR stimulation. Lower MALT1A expression and induction of MALT1A after T-cell stimulation was also observed in human CD4+ T cells from peripheral blood. We find differences in the levels of MALT1A/B in human and murine cells, but the different sources, purification protocols and stimulatory conditions preclude a quantitative comparison. We identified the RNA-binding protein hnRNP U as a negative regulator of exon7 inclusion in human Jurkat and murine primary T cells and we show that MALT1A upregulation enhances T-cell signalling and activation. Despite the induction of MALT1A, MALT1B remained the more abundant isoform, suggesting that not the absolute amounts, but the shifted balance in MALT1A versus MALT1B expression is defining downstream effects. The relevance of MALT1 alternative splicing is also underscored by the observation that MALT1A transcripts are elevated in vivo in T cells with a more activated phenotype such as effector memory T cells and TFH cells.

Alternative splicing is an important mechanism regulating cell function during the immune response14. Global analysis of splicing events using exon array demonstrated extensive alternative exon usage in many immune regulators during T-cell activation28. Alternative exon7 usage of MALT1 in T cells was never reported using exon arrays, most likely because the short exon7 cannot be detected in global analyses. TCR-induced inclusion of exon7 generates the hyperactive MALT1A isoform that provides an additional and functional TRAF6-binding motif that boosts NF-κB activation and slightly enhances JNK signalling in primary T cells. Also, in Jurkat T cells MALT1A was slightly more effective in triggering downstream signalling, but interestingly deletion of exon7 in MALT1B exerted a more severe effect than point mutation of T6BM1, suggesting that the role of exon7 may not be restricted to TRAF6 recruitment. Further, whereas in Jurkat T cells one of two T6BMs was largely sufficient to trigger full-NF-κB signalling, decreased signalling was seen after mutation of individual sites in CD4+ T cells. Thus, modulation of signalling strength by alternative MALT1 splicing seems to be more important in primary T cells, presumably to enhance weaker TCR signals. Constitutively expressed MALT1B seems to function as a molecular rheostat that limits the signalling strength in naive CD4+ T cells and MALT1A induction in activated T cells is required to overcome a threshold and to achieve a full response. Thus, we propose that TCR-induced MALT1 splicing is part of a positive feed-forward mechanism that is tuning T-cell signalling to allow productive T-cell activation.

MALT1 acts as a molecular scaffold protein to recruit the IKK complex to the CBM complex5, but it is also a protease which is activated on T-cell stimulation6,7. Since exon7 contains a functional TRAF6-binding site and TRAF6-dependent MALT1 ubiquitination drives NF-κB signalling5, the data suggest that exon7 inclusion augments MALT1 scaffolding. The E3 ligase TRAF6 can catalyse MALT1 poly-ubiquitination and trigger IKK activation3,5, but its role in T-cell activation has been questioned as TRAF6 ablation does not significantly affect TCR signalling to NF-κB and MAPK29. Nevertheless, our mutagenesis underscores an essential requirement of the TRAF6-binding motifs for MALT1 scaffolding function, suggesting that another E3 ligase may compensate for the loss of TRAF6. Clearly, inclusion of exon7 in MALT1A does not enhance protease function, which is in line with the results obtained by comparing Malt1−/− and MALT1 paracaspase mutant (Malt1PM) mice21,22,23,30. CD4+ T cells from both Malt1−/− and Malt1PM mice are unable to differentiate into TH17 cells22,24. Congruently, we show in reconstitution experiments in vitro that catalytically inactive MALT1 does not promote TH17 development, but both MALT1 splice variants ron editor lite - Crack Key For U TH17 differentiation. Further, our data indicate that even though TH1 differentiation is not completely relying on MALT1, the catalytic activity augments TH1 development. Thus, differentiation processes are apparently primarily driven by MALT1 protease function, which is required to remove the critical post-transcriptional regulators Roquin and Regnase-1 that counteract upregulation of TH17 differentiation factors such as IκBζ or IκBNS12,31,32,33. In contrast, proteolytic activity of MALT1 is largely dispensable for direct downstream signalling to NF-κB and JNK21,22,30, providing further evidence that the differential effects of MALT1 splice variants are caused by the scaffolding function. JNK activation has been connected to MALT1-catalysed CYLD cleavage10. However, MALT1 activity and CYLD cleavage were not affected by blocking MALT1A induction and JNK activation was also not impaired in T cells from Malt1PM mice21,22,30, revealing that JNK signalling in naive CD4+ T cells is not relying on MALT1 protease activity. Thus, biochemical and functional evidence demonstrates that alternative splicing modulates MALT1 scaffolding function, but not protease activity.

We identified several RNA-binding factors that influence splicing of MALT1 by either promoting inclusion (for example, hnRNP R, hnRNP LL and SRSF3) or skipping (for example, hnRNP H1, hnRNP A1, U2AF1 and hnRNP U) of exon7. Together with a minigene approach, the results indicate that MALT1 exon7 splicing is controlled by a complex machinery of positive and negative trans-acting factors as well as cis-acting RNA elements. In the screen, we identified hnRNP U as the most potent negative regulator of exon7 inclusion in Jurkat T cells. hnRNP U knockdown enhanced TCR-induced upregulation of MALT1A and T-cell activation, supporting the conclusion that alternative splicing of MALT1 modulates T-cell responses. hnRNP U is able to bind DNA and RNA, and it has been implicated in a variety of biological processes. Recent genome-wide studies revealed that hnRNP U is an important regulator of alternative splicing34,35. hnRNP U can promote exon skipping or inclusion in a highly context-dependent manner and it can act in conjunction with other splicing regulators. Since the initial search already indicated that multiple RNA-binding proteins impact on alternative MALT1 splicing, it seems reasonable to assume that MALT1A and MALT1B levels will be regulated by a network of splice factors. TCR stimulation induces the expression of hnRNP U, but at the same time putative MALT1A promoting splice factors such as hnRNP R, SRSF3 and SRSF9 are increased, suggesting that expression and competition of a complex network of positive and negative splice factors may control MALT1 splicing. Clearly, a more detailed understanding about these factors and their cis-acting elements is required to elucidate the mechanism how TCR signalling impacts on MALT1 splicing. hnRNP U was suggested to regulate splice site selection either by modulating the core splicing machinery or by directly targeting flowjo alternatives - Free Activators pre-mRNA35,36. The processes are not mutually exclusive and future studies must determine the exact mechanism how hnRNP U regulates exon7 splicing of MALT1. Little is known how cellular signalling pathways influence splicing. AKT signalling was shown to control hnRNP U- and hnRNP L-dependent Caspase-9 splicing36. Recently, JNK signalling was shown to induce alternative splicing of multiple targets including the MAP kinase kinase 7 (MKK7) upon T-cell activation37. It will be interesting to unravel if similar molecular mechanisms link TCR stimulation to MALT1 splicing.

We show that alternative MALT1 splicing impacts on signalling strength and induction of the hyperactive splice variant MALT1A pushes more robust T-cell activation. Such positive feed-forward regulation may facilitate to surpass thresholds for cellular decisions and they even can take place on the single-cell level. Thus, the relative MALT1A and MALT1B expression may trigger different programs in individual cells. Interestingly, intrinsic characteristics of T-cell signalling determine the fate of naive CD4+ T cells38. Strong TCR signalling favours TFH over TH1 development, but the underlying molecular mechanisms that translates the magnitude of TCR signalling into a response remains elusive. We find that induced MALT1 splicing augments TCR signalling to NF-κB and JNK, and that MALT1A expression in vivo is indeed high in TFH cells. We propose that MALT1 alternative splicing constitutes an early bifurcation point to translate TCR signalling into different T-cell activation states that may favour distinct fate decisions and effector functions in an immune response.

Methods

Mice

C57BL/6 mice were from Jackson laboratory and BALB/c as well as OT-II (C57BL/6Tg(TcraTcrb)425Cbn/Crl) mice were from Charles River. Malt1−/− and Malt1−/−R26/CAG-CARΔ1stop-flCd4-Cre mice (C57BL/6 genetic background) were described1,25. All experiments were performed using 8–16-week-old (C57BL/6, BALB/c, OT-II) or 10–30-week-old (Malt1−/− and Malt1−/−R26/CAG-CARΔ1stop-flCd4-Cre) male or female mice. All mice were housed in accordance with institutional guidelines. Immunization was done in accordance with established guidelines of the Regional Ethics Committee of Bavaria and animal protocols were approved by local authorities.

Antibodies and reagents

The following antibodies were used for stimulation, fluorescence-activated cell sorting FACS) staining and western blot and IP: anti-CD3 (145-2C11), anti-CD28 (37.51), Streptavidin-PE, anti-CXCR5 (RF8B2, unconjugated) and anti-NEMO (Clone 54; western blot; all from BD Biosciences); anti-Thy1.1-APC (HIS51), anti-IL-2-FITC or anti-IL-2-APC (JES6-5H4), anti-CD25-PE (PC61.5), anti-CD69-APC (H1.2F3), anti-CD2-APC (RPA-2.10), anti-TCR-β-Biotin (H57-597), anti-CD4-PerCP (RM4-5) and anti-PD-1-FITC (J43; all from eBioscience); anti-BCL10 (EP606Y), biotinylated goat anti-rat IgG, anti-hnRNP U (3G6) and anti-TRAF6 (EP591Y; all from Abcam); anti-CD62L-AlexaFluor 647 (MEL-14; from Biolegend); anti-CD44-AlexaFluor 405 (IM7; Caltag); anti-MALT1 (B12), anti-MALT1 (H300), anti-β-Actin (I-19), anti-p38 (C-20), anti-CYLD (E10) and anti-NEMO (FL-419; IP; all from Santa Cruz Biotechnology); anti-CARMA1 (1D12), anti-MALT1 (2494), anti-p-ERK (9101), anti-p-p38 (9211), anti-p-JNK (9255), anti-p-IκBα (9246), anti-IκBα (L35A5), anti-JNK (9252) (all from Cell signalling); anti-ERK (442704; Calbiochem); rabbit anti-syrian hamster IgG (dianova) and anti-Flag-M2 (from Sigma-Aldrich); horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch); and rabbit polyclonal antibody was raised against peptide GRTDEAVEC from MALT1A. For differentiation experiments, the following antibodies, reagents and cytokines were used: anti-CD3 (145-2C11), anti-CD28 (37N), anti-IL-12 (C17.8), anti-IL-4 (11B11), anti-IFN-γ (Xmg1.2) and anti-CD16/32 (2.4G2; produced by V.H. and E. Kremmer); anti-mIL-2 (JES6-5H4; Miltenyi); anti-CD45.2-APC-Cy7 (30-F11), anti-CD4-PE-Cy7 (GK1.5), anti-IFN-γ-APC (XMG1.2), anti-IL-17A-PE (eBio17B7; all from eBioscience); indol-1 for live/dead-cell viability assays (Life Technologies); recombinant mouse IL-12 (BD Biosciences) and recombinant mouse IL-6 and TGF-β (R&D Systems). The following reagents were used: recombinant human TNF-α (Biomol); Phorbol 12-myristate 13-acetate (PMA/P) and ionomycin (Iono/I; both from Calbiochem); murine anti-CD3/CD28 coated beads (anti-CD3: 13.3 μg ml−1; anti-CD28: 26.6 μg ml−1; Life Technologies); human T-Activator CD3/CD28 Dynabeads (Life Technologies); Protein G Sepharose (GE Healthcare); Strep-Tactin Sepharose (IBA); brefeldin-A (Sigma); OVA peptide (aa 323–339; ISQAVHAAHAEINEAGR; Biotrend), LumiGlo reagent (Cell Signaling), vivo-MOs: AMO, GAACCAAAGGATTGCACTACCTTCA and standard control (cMO), CCTCTTACCTCAGTTACAATTTATA (both from GeneTools). For siRNA knockdown experiments, the following siRNAs and shRNAs were used: ON-TARGETplus SMARTpool siRNA library (qPCR) and siGENOME SMARTpool siRNA library (radioactive PCR; all from Dharmacon). ON-TARGETplus Non-targeting pool (si-control) and ON-TARGETplus SMARTpool si-hnRNP U were used for further knockdown experiments. For verification of the SMARTpool effects, the following individual siRNAs were used: siRNA negative control (si-control), si-hnRNP U #1: 5′-ACAGAAAGGCGGAGAUAAAUU-3′, si-hnRNP U #2: 5′-GAAGAAAGAUUGUGAAGUUUU-3′; si-hnRNP U #3: GAUGAAGACUAUAAGCAAAUU (all Eurogentec). For adenoviral knockdown experiments, shRNAs directed against hnRNP U (sh-hnRNP U #1: 5′-CCATAACTGTGCAGTTGAATT-3′, sh-hnRNP U #2: 5′-GGCTGGTCACTAACCACAAGT-3′) and adenoviral control virus were purchased from Sirion Biotech. The following oligonucleotides were used for electrophoretic mobility shift assays: H2K (forward: 5′-GATCCAGGGCTGGGGATTCCCCATCTCCACAGG-3′, reverse: 5′- GATCCCTGTGGAGATGGGGAATCCCCAGCCCTG-3′), OCT1 (forward: 5′- GATCTGTCGAATGCAAATCACTAGAA-3′, reverse: 5′-GATCTTCTAGTGATTTGCATTCGACA-3′).

Cell culture and stimulation

Jurkat T cells were cultured in RPMI 1640 medium (Life Technologies) supplemented with 10% FCS and 100 U ml−1 penicillin/streptomycin (P/S, Life Technologies). Stimulation of Jurkat T cells was initiated by the addition of Phorbol 12-myristate 13-acetate (PMA) (200 ng ml−1) and ionomycin (300 ng ml−1) or TNF-α (10 ng ml−1). DMEM with 10% FCS, 100 U ml−1 P/S and 50 μM β-mercaptoethanol (Life Technologies) was used for culture of Phoenix packaging cells. Human embryonic kidney (HEK) 293 cells and MEFs were cultured in DMEM with 10% FCS and 100 U ml−1 P/S. For retroviral reconstitution experiments, CD4+ T cells from spleen and lymph nodes were isolated using mouse CD4+ T-cell-specific Dynabeads (Life Technologies). Differentiation experiments were performed using the naive CD4+ T-cell isolation kit (Miltenyi). For other experiments, isolation of murine CD4+ T cells was performed by negative magnetic-activated cell sorting (MACS) selection using the CD4+ T-cell isolation kit II (Miltenyi). Primary T cells were cultured in RPMI medium supplemented with 10% heat-inactivated FCS, 1% P/S, 1% NEAA (Life Technologies), 1% HEPES, 1% L-glutamine, 1% sodium pyruvate (Life Technologies) and 0.1% β-mercaptoethanol. CD4+ T cells were stimulated with anti-CD3 (0.5 μg ml−1) and anti-CD28 (1 μg ml−1) on plates precoated with rabbit anti-hamster IgG or anti-CD3/CD28-coated beads (3:1) or with PMA (30 ng ml−1) and ionomycin (300 ng ml−1). To analyse the isoform-specific effects regarding TH1 and TH17 differentiation, infected naive CD4+ T cells (0.2 × 106) were stimulated with anti-CD3 (1 μg ml−1) and irradiated APCs (2 × 106) from CD45.1 mouse (T:APC ratio is 1:10) in TH1 and TH17 culture conditions: TH1, IL-12 (10 ng ml−1) and anti-IL-4 (10 μg ml−1); TH17, TGF-β (10 μg ml−1), IL-6 (60 ng ml−1), anti-IL-12 (10 μg ml−1), anti-IL-4 (10 μg ml−1), anti-IFN-γ (5 μg ml−1) and anti-IL-2 (2.5 μg ml−1). Cells were cultured for 72 h until restimulation with PMA (20 nM) and ionomycin (1 μM) for 4 h. For restimulation, cells were washed twice with PBS and were incubated for 4 h with PMA (20 nM) and ionomycin (1 μM). To analyse differences in surface marker expression after adenoviral knockdown, cells (0.1–0.5 × 106) were stimulated using anti-CD3 precoated 96-well plates (0.5 μg ml−1) and soluble anti-CD28 (1 μg ml−1). To determine MALT1 splicing in CD4+ T cells from OT-II mice, APCs were prepared from spleen and lymph node cells of wild-type mice and depleted for TCR-β+ T cells (using anti-TCR-β-Biotin). After irradiation (2,000 rad), APCs (2 × 106) were pulsed with 1 μg ml−1 OVA peptide (aa 323–339) for 1 h at 37 °C, washed with PBS and subsequently incubated with OT-II CD4+ T cells (2 × 106) in a ratio 1:1 for 6 h before being lysed in RNA lysis buffer. Human CD4+ T cells were isolated from peripheral blood by negative MACS selection (Miltenyi), cultured in advanced RPMI 1640 medium supplemented with 10% heat-inactivated FCS and 2 mM L-glutamine (Life Technologies), and stimulated (2 × 106) with human T-Activator CD3/CD28 Dynabeads (Life Technologies). Written consent and approval by the ethics board of the Medical Faculty at the Technical University Munich was obtained for the use of peripheral blood from healthy donors.

Generation and reconstitution of MALT1-deficient T cells

Bicistronic expression vector px330 expressing Cas9 and sgRNA39,40 was digested with BbsI and the linearized vector was gel purified. A pair of oligos (5′-CCGTGGTCCAGATATATAGC-3′ and 5′-GGTTGAAGCAAATGCAATGC-3′) for each targeting site was annealed and ligated to the linearized vector. Jurkat T cells (2.5 × 106) were electroporated (220 V and 1,000 mA (Gene pulser X, Bio-Rad) with px330 plasmids expressing sgRNA targeting both the sides of the exon2 of the MALT1 gene as well as plasmid bearing a puromycin selection cassette. At 24 h after electroporation, puromycin (2 μg ml−1) was added and taken off after 48 h. Isolation of clonal cell lines was achieved by serial dilutions and was followed by an appropriate expansion period. Cell clones were genotyped using PCR with intronic primers flanking both the sides of exon 2. MALT1 expression in exon2-deleted cells was analysed by western blot. For reconstitution, MALT1 isoforms were linked to Flag-Strep-Strep tag and hΔCD2 by a co-translational processing site T2A41 and introduced into pHAGE plasmids. Lentivirus was produced by transfecting sub-confluent HEK293T cells with 1.5 μg PAX, 1 μg pMD2G and 2 μg transfer vector. After 72 h, lentivirus was collected, filtered and Jurkat T cells (0.5 × 106 cells) were infected in the presence of 8 μg ml−1 polybrene. After 24 h, virus was replaced with RPMI medium. After 1 week in culture, FACS analysis revealed >95% ΔCD2-positive cells.

Retroviral and adenoviral transduction of CD4+ T cells

Retroviruses were produced in Phoenix cells transfected with pMSCV plasmids carrying human VNC Connect Enterprise 6.7.4 Crack With License Key Latest 2021 constructs and Thy1.1 (separated by internal ribosome entry site (IRES) sequence) and viruses were collected after 48 and 72 h. For retroviral reconstitution, CD4+ T cells from Malt1−al mice were simulated with plate-bound anti-CD3/anti-CD28 for 48 h and afterwards infected with retroviral supernatant supplemented with Polybrene (8 μg ml−1). After 6-h incubation, cells were resuspended in media supplemented with 20 U ml−1 IL-2 and expanded for another 72 h. Thy1.1-positive cells were purified by MACS (Miltenyi) yielding populations of ∼90% Thy1.1-positive T cells. Cells were then restimulated with plate-bound anti-CD3/anti-CD28 or P/I.

For T-cell differentiation experiments, full-length MALT1A, MALT1B or MALT1A C464A mutant were cloned in the pCAGAdDu-IRES-eGFP vector. HEK293A cells (1 × 105) were transfected with 3 μg linearized plasmids using jetPEI reagent (Polyplus transfection). When all cells show cytopathic effects, cells were detached and primary virus was collected by three freeze–thaw cycles. Primary virus was amplified in HEK293A cells using an multiplicity of infection (MOI) of 50 and virus lysate was collected by freeze–thaw cycles after cytopathic effect. For adenoviral knockdown, adenoviruses encoding control or sh-hnRNP U #1 and #2 (identified above) were purchased from Sirion Biotech and amplified in HEK293A cells (200 μl). Virus was titrated using A549 cells. For differentiation experiments, naive CD4+ T cells from Malt1−/−R26/CAG-CARΔ1stop-flCd4-Cre mice were transduced with GFP control, MALT1A, MALT1B or MALT1A C464A virus using an MOI of 50. CD4+ T cells from R26/CAG-CARΔ1stop-flCd4-Cre mice were infected with control or sh-hnRNP U virus (MOI of 50). After 5 h of infection, cells were washed twice with PBS, resuspended in primary T-cell medium and rested for 40 h before sorting of GFP+ CD4+ T cells using FACS Star PLUS (BD) and stimulation. Transduction efficiency was determined by FACS. T-cell differentiation experiments were conducted as indicated above.

Cell lysis and IP

For analysis of expression levels or activation of signalling pathways, cells (1–5 × 106) were lysed in high-salt buffer (20 mM HEPES (pH 7.9), 350 mM NaCl, 20% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.1 mM EGTA, 1% NP-40, 1 mM dithiothreitol (DTT), 10 mM sodium fluoride, 8 mM β-glycerophosphate, 300 μM sodium vanadate and protease inhibitor cocktail). For binding studies, cells (1–5 × 107) were lysed in co-IP buffer (25 mM HEPES (pH 7.5), 150 mM NaCl, 0.2% NP-40, 10% glycerol, 1 mM DTT, 10 mM sodium fluoride, 8 mM β-glycerophosphate, 300 μM sodium vanadate and protease inhibitor cocktail). Lysate controls were mixed with 4 × SDS-loading dye and boiled. IP was carried out using antibodies against NEMO (9 μl) or MALT1A (15 μl) overnight at 4 °C. After antibody incubation, Protein G Sepharose (20 μl 1:1 suspension) was added and incubated for 1–2 h at 4 °C. For Strep-tagged proteins, precipitation was performed using Strep-Tactin Sepharose (30 μl 1:1 suspension) at 4 °C overnight. Beads were washed with co-IP buffer and boiled after addition of 20 μl 2 × SDS-loading dye. Lysates and IPs were separated by SDS–polyacrylamide gel electrophoresis (SDS–PAGE) and analysed by western blot.

Western blot

Proteins were transferred onto polyvinylidene difluoride membranes for immunodetection using electrophoretic semi-dry transfer system. After transfer, membranes were blocked with 3% bovine serum albumin (BSA) for 1 h at room temperature and incubated with specific primary antibody (indicated above, dilution 1:1,000 in 1.5% BSA/PBS-T) overnight at 4 °C. Membranes were washed in PBS-T before addition of HRP-coupled secondary antibodies (indicated above, 1:7,000 in 0.75% BSA in PBS-T; 1 h, room temperature). HRP was detected by enhanced chemiluminescence using the LumiGlo reagent (Cell Signaling) according to the manufacturer’s instructions. Images have been cropped for presentation. Full-size images are presented in Supplementary Fig. 7.

Electrophoretic mobility shift assay

For electrophoretic mobility shift assays, double-stranded NF-κB or OCT1-binding sequences (H2K or OCT1 see reagents) were labelled with [α-32P] dATP using Klenow Fragment (NEB). To monitor DNA binding, whole-cell lysates (3–6 μg) were incubated for 30 min at room temperature with shift-buffer (HEPES (pH 7.9; 20 mM), KCl (120 mM), Ficoll (4%)), DTT (5 mM), BSA (10 μg) and poly-dI-dC (2 μg, Roche), and radioactive probe (10,000–20,000 c.p.m.). Samples were separated on a 5% polyacrylamide gel in TBE buffer, vacuum-dried and exposed to autoradiography. To determine NF-κB fold induction, intensities of NF-κB bands were quantified relative to OCT1 signal using ImageJ software. Images have been cropped for presentation. Full-size images are presented in Supplementary Fig. 7.

Flow cytometry

For surface protein staining, unspecific binding was blocked with anti-CD16/32 (dilution 1:50) in FACS buffer (PBS with 2% FCS and 0.01% sodium azide) and cells were stained with monoclonal antibodies (dilution 1:100). For intracellular IL-2 staining, cells (0.5–1 × 106) were stimulated for 6 h with anti-CD3/anti-CD28 in the presence of brefeldin-A (10 ng ml−1, Sigma) for 3 h before staining. Dead cells were excluded with ethidium monoazide bromide (dilution 1:100). Cells were fixed in 2% paraformaldehyde and permeabilized in PBS/0.5% Saponin/1% BSA. Unspecific binding was blocked with mouse anti-CD16/32 (dilution 1:50) and staining was performed with corresponding antibodies (indicated above, dilution 1:100). For T-cell differentiation experiments, cells were stimulated for 4 h with PMA (20 nM) and ionomycin (1 μM) in the presence of brefeldin-A for 2 h before staining. Afterwards, fixable dead-cell staining (indol-1) was performed for 30 min at 4 °C, followed by autodesk sketchbook pro 8 full version free download - Crack Key For U staining (anti-CD45.2, anti-CD4; dilution 1:200). Cells were fixed for 10 min at 20 °C with 4% paraformaldehyde and were permeabilized for 20 min at 4 °C in PBS/0.5% Saponin/1% BSA. The cells were then stained for 50 min at 4 °C with antibodies detecting IL-17A and IFNγ (dilution 1:200 each). Samples were acquired on LSRII or LSR Fortessa (BD) or Attune Acoustic Focusing Cytometer (Life Technologies) and analysed with FlowJo software (Tree Star).

Immunization and isolation of different T-cell subsets

For isolation of different T-cell subsets, BALB/c mice were immunized intravenous with ∼2 × 108 sheep erythrocytes (Acila AG, Mörfelden, Germany). After 1 week, the spleens were collected and single-cell suspensions prepared. To enrich for T cells, B cells were depleted using anti-CD19 microbeads (Miltenyi) according to the manual. Cells were then stained using following antibodies and reagents for 20 min on ice: anti-CXCR5, biotinylated goat anti-rat IgG, Streptavidin-PE, anti-CD4-PerCP, anti-PD-1-FITC, anti-CD62L-AlexaFluor 647 and anti-CD44-AlexaFluor 405. After washing, different T-cell subsets (CD4+CD62L+CD44 naive T cells, CD4+CD62LCD44+ effector T cells and CD4+CXCR5+PD1+ TFH cells) were sorted on a FACS Aria cell sorter (BD) and subsequently lysed in Trizol for RNA extraction.

MALT1 activity detection using MALT1-ABPs

MALT1-ABPs (6 and 7) have been described previously19. To investigate MALT1 activity of different MALT1-Strep constructs, Jurkat T cells (2–5 × 107) were lysed in 900 μl co-IP buffer, centrifuged (14,000 r.p.m., 4 °C, 10 min) and overexpressed MALT1-Strep constructs were precipitated using Strep-Tactin Sepharose. After three washing steps with co-IP buffer, bead-bound MALT1-Strep was incubated with 3 μM fluorescent MALT1-ABP (probe 6: BODIPY-LRSR-AOMK) for 1 h at 30 °C, mixed with 4 × loading dye and boiled. Proteins were separated by SDS–PAGE and fluorescence was detected by a Typhoon Scanner (FITC laser 488 nm/filter 526 SP). A plate assay enzyme-linked activity sorbent assay was used to detect active MALT1 in primary CD4+ T cells. Cells (1 × 107) were lysed in 200 μl co-IP buffer, centrifuged (14,000g, 4 °C, 10 min) and extract was incubated with 0.1 μM biotinylated MALT1-ABP (probe 7: BIOTIN-KLRSR-AOMK). Extract was transferred to streptavidin-coated plates (Thermo Scientific) and incubated overnight at 4 °C. After washing in PBS-T (0.05% Tween-20) and blocking with 2% BSA in PBS-T, detection was performed by incubation with MALT1 primary antibody (1:800 in 1% BSA in PBS-T; 1 h, room temperature) and HRP-coupled secondary antibody (1:1,500 in 1% BSA in PBS-T; 1 h, room temperature). Three to five washing steps with PBS-T were used after antibody incubation. Luminescence was determined after 3,3′,5,5′-Tetramethylbenzidin (TMB) substrate incubation for 10–20 min and subsequent stop reaction with 1 M H2SO4 in a photometer (Bio-Tek) at 450 and 570 nm.

Cell transfection

Transfection of HEK293 cells with pEF Flag-MALT1 plasmids (2 μg) was performed by calcium flowjo alternatives - Free Activators transfection. For knockdown experiments using vivo morpholinos, CD4+ T cells (3 × 106) or MEFs (0.5 × 106) were transfected with 5 nmol of AMO or cMO and cultured for 3 h (RNA) or 18 h (protein). After MO transfection, primary T cells were stimulated with either plate-bound or bead-coupled anti-CD3/CD28 or P/I. Knockdown efficiency was determined by qPCR. For siRNA knockdown, Jurkat T cells were transfected with 100 nM siRNA and Atufect transfection reagent (0.5–1 μg ml−1; Silence Therapeutics) and analysed after 72 h. For minigene analysis, after 48 h of siRNA-transfecion, Jurkat T cells (2.5 × 106) were electroporated with 1 μg minigene 1 (M1) or 2 (M2) using 220 V and 1,000 mA (Gene pulser X, Bio-Rad), cultivated for 24 h and subsequently lysed in protein or RNA lysis buffer. For siRNA screen using radioactive PCR, 1 × 106 Jurkat T cells were transfected with siRNA (10 pmol, from siGenome SMARTpool) using the Amaxa Nucleofector and the manufacture’s protocol for Jurkat T cells. RNA was analysed 60 h post transfection.

RNA-binding protein IP and minigene

RIP was performed using the Magna RIP kit (Merck Millipore) according to the manual. Purified RNA was analysed by qPCR. RIP RNA fractions were normalized to the corresponding RNA input fractions and calculated relative to IgG control (IgG control set as 1). For the minigene assay, genomic MALT1 region for M1 and M2 were amplified by PCR from human genomic clone pBACe3.6 (Source BioScience) and cloned between constant CD45 exons (exon3 and exon7) in a minigene vector42. After transfection (as indicated above), RNA was isolated and reverse transcribed. To analyse MALT1 exon7 inclusion or exclusion of M1 and M2, two specific vector backbone primers (CD45 exon3 forward and CD45 exon7 reverse) were used to amplify alternatively spliced minigene products. RP2 levels served as internal control. PCR primers are listed in Supplementary Table 2 and 3.

RNA preparation and qPCR

RNA was isolated (Qiagen RNeasy Kit) with subsequent DNase treatment (Promega) and reverse transcribed (Verso cDNA synthesis kit, Thermo Fisher). For qPCR, a LightCycler 480 from Roche was used with LightCycler SYBR Green I Master Mix. Semi-qPCR was performed using DreamTaq Polymerase (Thermo Fisher). For siRNA screen using MALT1 splicing-sensitive radioactive PCR, RNA was analysed with primers in flanking constant exons (ex6 and ex9/10). Products were analysed by denaturing PAGE and Phosphoimager quantification. PCR primers are listed in Supplementary Table 2 and 3.

Additional information

How to cite this article: Meininger, I. et al. Alternative splicing of MALT1 controls signalling and activation of CD4+ T cells. Nat. Commun. 7:11292 doi: 10.1038/ncomms11292 (2016).

References

  1. 1

    Ruland, J., Duncan, G. S., Wakeham, A. & Mak, T. W. Differential requirement for Malt1 in T and B cell antigen receptor signaling. Immunity19, 749–758 (2003).

    CASArticle Google Scholar

  2. 2

    Ruefli-Brasse, A. A., French, D. M. & Dixit, V. M. Regulation of NF-kappaB-dependent lymphocyte activation and development by paracaspase. Science302, 1581–1584 (2003).

    ADSCASArticle Google Scholar

  3. 3

    Sun, L., Deng, L., Ea, C. K., Xia, Z. P. & Chen, Z. J. The TRAF6 ubiquitin ligase and TAK1 kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Mol. Cell14, 289–301 (2004).

    CASArticle Google Scholar

  4. 4

    Noels, H. et al. A Novel TRAF6 binding site in MALT1 defines distinct mechanisms of NF-kappaB activation by API2middle dotMALT1 fusions. J. Biol. Chem.282, 10180–10189 (2007).

    CASArticle Google Scholar

  5. 5

    Oeckinghaus, A. et al. Malt1 ubiquitination triggers NF-kappaB signaling upon T-cell activation. EMBO J.26, 4634–4645 (2007).

    CASArticlePubMedPubMed Central Google Scholar

  6. 6

    Coornaert, B. et al. T cell antigen receptor stimulation induces MALT1 paracaspase-mediated cleavage of the NF-kappaB inhibitor A20. Nat. Immunol.9, 263–271 (2008).

    CASArticlePubMedPubMed Central Google Scholar

  7. 7

    Rebeaud, F. et al. The proteolytic activity of the paracaspase MALT1 is key in T cell activation. Nat. Immunol.9, 272–281 (2008).

    CASArticlePubMedPubMed Central Google Scholar

  8. 8

    Duwel, M. et al. A20 negatively regulates T cell receptor signaling to NF-kappaB by cleaving Malt1 ubiquitin chains. J. Immunol.182, 7718–7728 (2009).

    ArticlePubMed Google Scholar

  9. 9

    Hailfinger, S. et al. Malt1-dependent RelB cleavage promotes canonical NF-kappaB activation in lymphocytes and lymphoma cell lines. Proc. Natl Acad. Sci. USA108, 14596–14601 (2011).

    ADSCASArticlePubMed Google Scholar

  10. 10

    Staal, J. et al. T-cell receptor-induced JNK activation requires proteolytic inactivation of CYLD by MALT1. EMBO J.30, 1742–1752 (2011).

    CASArticlePubMedPubMed Central Google Scholar

  11. 11

    Uehata, T. et al. Malt1-induced cleavage of regnase-1 in CD4(+) helper T cells regulates immune activation. Cell153, 1036–1049 (2013).

    CASArticlePubMedPubMed Central Google Scholar

  12. 12

    Jeltsch, K. M. et al. Cleavage of roquin and regnase-1 by the paracaspase MALT1 releases their cooperatively repressed targets to promote T17 differentiation. Nat. Immunol.15, 1079–1089 (2014).

    CASArticlePubMedPubMed Central Google Scholar

  13. 13

    Klein, T. et al. The paracaspase MALT1 cleaves HOIL1 reducing linear ubiquitination by LUBAC to dampen lymphocyte NF-kappaB signalling. Nat. Commun.6, 8777 (2015).

    CASArticlePubMedPubMed Central Google Scholar

  14. 14

    Martinez, Archicad 2019 crack. M. & Lynch, K. W. Control of alternative splicing in immune responses: many regulators, many predictions, much still to learn. Immunol. Rev.253, 216–236 (2013).

    ArticlePubMedPubMed Central ram booster for pc games Google Scholar

  15. 15

    Hong, C. et al. Activated T cells secrete an alternatively spliced form of common gamma-chain that inhibits cytokine signaling and exacerbates inflammation. Immunity40, 910–923 (2014).

    CASArticlePubMedPubMed Central Google Scholar

  16. 16

    Magistrelli, G. et al. A soluble form of CTLA-4 generated by alternative splicing is expressed by nonstimulated human T cells. Eur. J. Immunol.29, 3596–3602 (1999).

    CASArticlePubMed Google Scholar

  17. 17

    Hermiston, M. L., Xu, Z. & Weiss, A. CD45: a critical regulator of signaling thresholds in immune cells. Annu. Rev. Immunol.21, 107–137 (2003).

    CASArticle Google Scholar

  18. 18

    Rothrock, C., Cannon, B., Hahm, B. & Lynch, K. W. A conserved signal-responsive sequence mediates activation-induced alternative splicing of CD45. Mol. Cell12, 1317–1324 (2003).

    CASArticlePubMed Google Scholar

  19. 19

    Eitelhuber, A. C. et al. Activity-based probes for detection of active MALT1 paracaspase in immune cells and lymphomas. Chem. Biol.22, 129–138 (2015).

    CASArticlePubMed Google Scholar

  20. 20

    Pelzer, C. et al. The protease activity of the paracaspase MALT1 is controlled by monoubiquitination. Nat. Immunol.14, 337–345 (2013).

    CASArticlePubMed Google Scholar

  21. 21

    Jaworski, M. et al. Malt1 protease inactivation efficiently dampens immune responses but causes spontaneous autoimmunity. EMBO J.33, 2765–2781 (2014).

    CASArticlePubMedPubMed Central Google Scholar

  22. 22

    Bornancin, F. et al. Deficiency of MALT1 paracaspase activity results in unbalanced regulatory and effector T and B cell responses leading to multiorgan inflammation. J. Immunol.194, 3723–3734 (2015).

    CASArticlePubMed Google Scholar

  23. 23

    Yu, J. W. et al. MALT1 Protease Activity Is Required for Innate and Adaptive Immune Responses. PLoS ONE10, e0127083 (2015).

    ArticlePubMedPubMed Central Google Scholar

  24. 24

    Brustle, A. et al. The NF-kappaB regulator MALT1 determines the encephalitogenic potential of Th17 cells. J. Clin. Invest.122, 4698–4709 (2012).

    CASArticlePubMedPubMed Central Google Scholar

  25. 25

    Heger, K. et al. A novel Cre recombinase reporter mouse strain facilitates selective and efficient infection of primary immune cells with adenoviral vectors. Eur. J. Immunol.45, 1614–1620 (2015).

    CASArticlePubMed Google Scholar

  26. 26

    Risso, A. et al. CD69 in resting and activated T lymphocytes. Its association with a GTP binding protein and biochemical requirements for its expression. J. Immunol.146, 4105–4114 (1991).

    CASPubMed Google Scholar

  27. 27

    Thome, M., Charton, J. E., Pelzer, C. & Hailfinger, S. Antigen receptor signaling to NF-kappaB via CARMA1, BCL10, and MALT1. Cold Spring Harb. Perspect. Biol.2, a003004 (2010).

    ArticlePubMedPubMed Central Google Scholar

  28. 28

    Ip, J. Y. et al. Global analysis of alternative splicing during T-cell activation. RNA13, 563–572 (2007).

    CASArticlePubMedPubMed Central Google Scholar

  29. 29

    King, C. G. et al. TRAF6 is a T cell-intrinsic negative regulator required for the maintenance of immune homeostasis. Nat. Med.12, 1088–1092 (2006).

    CASArticlePubMed Google Scholar

  30. 30

    Gewies, A. et al. Uncoupling Malt1 threshold function from paracaspase activity results in destructive autoimmune inflammation. Cell Rep.9, 1292–1305 (2014).

    CASArticlePubMedPubMed Central Google Scholar

Источник: https://www.nature.com/articles/ncomms11292

Wikipedia

Multilingual free online encyclopedia

This article is about Wikipedia. For Wikipedia's home page, see Main Page. For the English edition, see English Wikipedia. For a list of Wikipedias in other languages, see List of Wikipedias. For other uses, see Wikipedia (disambiguation).

Wikipedia (wik-ih-PEE-dee-ə or wik-ee-) is a free content, multilingual online encyclopedia written and maintained by a community of volunteers through a model of open collaboration, using a wiki-based editing system. Individual contributors, also called editors, are known as Wikipedians. It is the largest and most-read reference work in history,[3] and consistently one of the 15 most popular websites ranked by Alexa; as of 2021,[update] Wikipedia was ranked the 13th most popular site.[3][4] A visitor spends an average time on Wikipedia of 3 minutes and 45 seconds each day.[5] It is hosted by the Wikimedia Foundation, an American non-profit organization funded mainly through small donations.[6]

Wikipedia was launched on January 15, 2001, by Jimmy Wales[7] and Larry Sanger; Sanger coined its name as a blending of "wiki" and "encyclopedia".[8] Initially available only in English, versions in other languages were quickly developed. Its combined editions comprise more than 57 million articles, attracting around 2 billion unique device visits per month, and more than 17 million edits per month (1.9 edits per second).[10][11] In 2006, Time magazine stated that the policy of allowing anyone to edit had made Wikipedia the "biggest (and perhaps best) encyclopedia in the world", and is "a testament to the vision of one man, Jimmy Wales".[12]

Wikipedia has received praise for its enablement of the democratization of knowledge, extent of coverage, unique structure, culture, and reduced amount of commercial bias, but criticism for exhibiting systemic bias, particularly gender bias against women and alleged ideological bias.[13][14]Its reliability was frequently criticized in the 2000s, but has improved over time and has been generally praised in the late 2010s and early 2020s.[3][13][15] Its coverage of controversial topics such as American politics and major events such The Foundry Katana Crack 4.0v4(x64) Free [Latest Version] the COVID-19 pandemic has received substantial media attention. It has been censored by world governments, ranging from specific pages to the entire site. It has become an element of popular culture, with references in books, films and academic studies. In 2018, Facebook and YouTube announced that they would help users detect fake news by suggesting fact-checking links to related Wikipedia articles.[16][17]

History

Main article: History of Wikipedia

Nupedia

Main article: Nupedia

Logo reading "Nupedia.com the free encyclopedia" in blue with the large initial "N"
Wikipedia originally developed from another encyclopedia project called Nupedia.

Other collaborative online encyclopedias were attempted before Wikipedia, but none were as successful.[18] Wikipedia began as a complementary project for Nupedia, a free online English-language encyclopedia project whose articles were written by experts and reviewed under a formal process.[19] It was founded on March 9, 2000, under the ownership of Bomis, a web portal company. Its main figures were Bomis CEO Jimmy Wales and Larry Sanger, editor-in-chief for Nupedia and later Wikipedia.[1][20] Nupedia was initially licensed under its own Nupedia Open Content License, but even before Wikipedia was founded, Nupedia switched to the GNU Free Documentation License at the urging of Richard Stallman.[21] Wales is credited with defining the goal of making a publicly editable encyclopedia,[22][23] while Sanger is credited with the strategy of using a wiki to reach that goal.[24] On January 10, 2001, Sanger proposed on the Nupedia mailing list to create a wiki as a "feeder" project for Nupedia.[25]

Launch and early growth

The domainswikipedia.com (later redirecting to wikipedia.org) and wikipedia.org were registered on January 12, 2001,[26] and January 13, 2001,[27] respectively, and Wikipedia was launched on January 15, 2001[19] as a single English-language edition at www.wikipedia.com,[28] and announced by Sanger on the Nupedia mailing list.[22] Its policy of "neutral point-of-view"[29] was codified in its first few months. Otherwise, there were initially relatively few rules, and it operated independently of Nupedia.[22] Bomis originally intended it as a business for profit.[30]

The Wikipedia home page on December 20, 2001

English Wikipedia editors with >100 edits per month[31]

Wikipedia gained early contributors from Nupedia, Slashdot postings, and web search engine indexing. Language editions were also created, with a total of 161 by the end of 2004.[33] Nupedia and Wikipedia coexisted until the former's servers were taken down permanently in 2003, and its text was incorporated into Wikipedia. The English Wikipedia passed the mark of two million articles on September 9, 2007, making it the largest encyclopedia ever assembled, surpassing the Yongle Encyclopedia made during the Ming Dynasty in 1408, which had held the record for almost 600 years.[34]

Citing fears of commercial advertising and lack of control, users of the Spanish Wikipediaforked from Wikipedia to create Enciclopedia Libre in February 2002.[35] Wales then announced that Wikipedia would not display advertisements, and changed Wikipedia's domain from wikipedia.com to wikipedia.org.[36][37]

Though the English Wikipedia reached three million articles Zero Assumption Recovery 10.0.1957 Free Download with Crack August 2009, the growth of the edition, in terms of the numbers of new articles and of editors, appears to have peaked around early 2007.[38] Around 1,800 articles were added daily to the encyclopedia in 2006; by 2013 that average was roughly 800.[39] A team at the Palo Alto Research Center attributed this slowing of growth to the project's increasing exclusivity and resistance to change.[40] Others suggest that the growth is flattening naturally because articles that could be called "low-hanging fruit"—topics that clearly merit an article—have already been created and built up extensively.[41][42][43]

In November 2009, a researcher at the Rey Juan Carlos University in Madrid found that the English Wikipedia had lost 49,000 flowjo alternatives - Free Activators during the first three months of 2009; in comparison, it lost only 4,900 editors during the same period in 2008.[44][45]The Wall Street Journal cited the array of rules applied to editing and disputes related to such content among the reasons for this trend.[46] Wales disputed these claims in 2009, denying the decline and questioning the study's methodology.[47] Two years later, in 2011, he acknowledged a slight decline, noting a decrease from "a little more than 36,000 writers" in June 2010 to 35,800 in June 2011. In the same interview, he also claimed the number of editors was "stable and sustainable".[48] A 2013 MIT Technology Review article, "The Decline of Wikipedia", questioned this claim, revealing that since 2007, Wikipedia had lost a third of its volunteer editors, and that those remaining had focused increasingly on minutiae.[49] In July 2012, The Atlantic reported that the number of administrators was also in decline.[50] In the November 25, 2013, issue of New York magazine, Katherine Ward stated, "Wikipedia, the sixth-most-used website, is facing an internal crisis."[51]

Milestones

Cartogramshowing number of articles in each European language as of January 2019.[update]One square represents 10,000 articles. Languages with fewer than 10,000 articles are represented by one square. Languages are grouped by language family and each language family is presented by a separate color.

In January 2007, Wikipedia first became one of the ten most popular websites in the US, according to comscore Networks. With 42.9 million unique visitors, it was ranked #9, surpassing The New York Times (#10) and Apple (#11). This marked a significant increase over January 2006, when Wikipedia ranked 33rd, with around 18.3 million unique visitors.[52] As of March 2020[update], it ranked 13th[4] in popularity according to Alexa Internet. In 2014, it received eight billion page views every month.[53] On February 9, 2014, The New York Times reported that Wikipedia had 18 billion page views and nearly 500 million unique visitors a month, "according to the ratings firm comScore".[10] Loveland and Reagle argue that, in process, Wikipedia follows a long tradition of historical encyclopedias that have accumulated improvements piecemeal through "stigmergic accumulation".[54][55]

On January 18, 2012, the English Wikipedia participated in a series of coordinated protests against two proposed laws in the United States Congress—the Stop Online Piracy Act (SOPA) and the PROTECT IP Act (PIPA)—by blacking out its pages for 24 hours.[56] More than 162 million people viewed the blackout explanation page that temporarily replaced its content.[57][58]

On January 20, 2014, Subodh Varma reporting for The Economic Times indicated that not only had Wikipedia's growth stalled, it "had lost nearly ten percent of its page views last year. There was a decline of about two billion between December 2012 and December 2013. Its most popular versions are leading the slide: page-views of the English Wikipedia declined by twelve percent, those of German version slid by 17 percent and the Japanese version lost nine percent."[59] Varma added, "While Wikipedia's managers think that this could be due to errors in counting, other experts feel that Google's Knowledge Graphs project launched last year may be gobbling up Wikipedia users."[59] When contacted on this matter, Clay Shirky, associate professor at New York University and fellow at Harvard's Berkman Klein Center for Internet & Society said that he suspected much of the page-view decline was due to Knowledge Graphs, stating, "If you can get your question answered from the search page, you don't need to click [any further]."[59] By the end of December 2016, Wikipedia was ranked the 5th most popular website globally.[60]

In January 2013, 274301 Wikipedia, an asteroid, was named after Wikipedia; in October 2014, Wikipedia was honored with the Wikipedia Monument; and, in July 2015, 106 of the 7,473 700-page volumes of Wikipedia became available as Print Wikipedia. In April 2019, an Israeli lunar lander, Beresheet, crash landed on the surface of the Moon carrying a copy of nearly all of the English Wikipedia engraved on thin nickel plates; experts say the plates likely survived the crash.[61][62] In June 2019, scientists reported that all 16 GB of article text from the English Wikipedia had been encoded into synthetic DNA.[63]

Current state

On January 23, 2020, the English-language Wikipedia, which is the largest language section of the online encyclopedia, published its six millionth article.

By February 2020, Wikipedia ranked eleventh in the world in terms of Internet traffic.[64] As a key resource for disseminating information related to COVID-19, the World Health Organization has partnered with Wikipedia to help combat the spread of misinformation.[65][66]

Wikipedia accepts cryptocurrency donations and Basic Attention Token.[67][68][69]

Openness

Differences between versions of an article are highlighted

Unlike traditional encyclopedias, Wikipedia follows the procrastination principle[note 3] regarding the security of its content.[70]

Restrictions

Due to Wikipedia's increasing popularity, some editions, including the English version, have introduced editing restrictions for certain cases. For instance, on the English Wikipedia and some other language editions, only registered users may create a new article.[71] On the English Wikipedia, among others, particularly controversial, sensitive or vandalism-prone pages have been protected to varying degrees.[72][73] A frequently vandalized article can be "semi-protected" or "extended confirmed protected", meaning that only "autoconfirmed" or "extended confirmed" editors can modify it.[74] A particularly contentious article may be locked so that only administrators can make changes.[75] A 2021 article in the Columbia Journalism Review identified Wikipedia's page-protection policies as "[p]erhaps the most important" means at its disposal to "regulate its market of ideas".[76]

In certain cases, all editors are allowed to submit modifications, but review is required for some editors, depending on certain conditions. For example, the German Wikipedia maintains "stable versions" of articles[77] which have passed certain reviews. Following protracted trials and community discussion, the English Wikipedia introduced the "pending changes" system in December 2012. Under this system, new and unregistered users' edits to certain controversial or vandalism-prone articles are reviewed by established users before they are published.[79]

Wikipedia's editing interface

Review of changes

Although changes are not systematically reviewed, the software that powers Wikipedia provides tools allowing anyone to review changes made by others. Each article's History page links to each flowjo alternatives - Free Activators 4][80] On most articles, anyone can undo others' changes by clicking a link on the article's History page. Anyone can view the latest changes to articles, and anyone registered may maintain a "watchlist" of articles that interest them so they can be notified of changes. "New pages patrol" is a process where newly created articles are checked for obvious problems.[81]

In 2003, economics Ph.D. student Andrea Ciffolilli argued that the low transaction costs of participating in a wiki created a catalyst for collaborative development, and that features such as allowing easy access to past versions of a page favored "creative construction" over "creative destruction".[82]

Vandalism

Main article: Vandalism on Wikipedia

Any change or edit that manipulates content in a way that purposefully compromises Wikipedia's integrity is considered vandalism. The most common and obvious types of vandalism include additions of obscenities and crude humor; it can also include advertising and other types of spam.[83] Sometimes editors commit vandalism by removing content or entirely blanking a given page. Less common types of vandalism, such as the deliberate addition of plausible but false information, can be more difficult to detect. Vandals can introduce irrelevant formatting, modify page semantics such as the page's title or categorization, manipulate the article's underlying code, or use images disruptively.[84]

Obvious vandalism is generally easy to remove from Wikipedia articles; the median time to detect and fix it is a few minutes.[85][86] However, some vandalism takes much longer to detect and repair.[87]

In the Seigenthaler biography incident, an anonymous editor introduced false information into the biography of American political figure John Seigenthaler in May 2005, falsely presenting him as a suspect in the assassination of John F. Kennedy.[87] It remained uncorrected for four months.[87] Seigenthaler, the founding editorial director of USA Today and founder of the Freedom ForumFirst Amendment Center at Vanderbilt University, called Wikipedia co-founder Jimmy Wales and asked whether he had any way of knowing who contributed the misinformation. Wales said he did not, although the perpetrator was eventually traced.[88][89] After the incident, Seigenthaler described Wikipedia as "a flawed and irresponsible research tool".[87] The incident led to policy changes at Wikipedia for tightening up the verifiability of biographical articles of living people.[90]

In 2010, Daniel Tosh encouraged viewers of his show, Tosh.0, to visit the show's Wikipedia article and edit it at will. On a later episode, he commented on the edits to the article, most of them offensive, which had been made by the audience and had prompted the article to be locked from editing.[91][92]

Edit warring

Wikipedians often have disputes regarding content, which may result in repeated competing changes to an article, known as "edit warring".[93][94] It is widely seen as a resource-consuming scenario where no useful knowledge is added,[95] and criticized as creating a competitive[96] and conflict-based[97] editing culture associated with traditional masculine gender roles.[98]

Policies and laws

Content in Wikipedia is subject to the laws (in particular, copyright laws) of the United States and of the US state of Virginia, where the majority of Wikipedia's servers are located. Beyond legal matters, the editorial principles of Wikipedia are embodied in the "five pillars" and in numerous policies and guidelines intended to appropriately shape content. Even these rules are stored in wiki form, and Wikipedia editors write and revise the website's policies and guidelines.[99] Editors can enforce these rules by deleting or modifying non-compliant material. Originally, rules on the non-English editions of Wikipedia were based on a translation of the rules for the English Wikipedia. They have since diverged to some extent.[77]

Content policies and guidelines

According to the rules on the English Wikipedia, each entry in Wikipedia must be about a topic that is encyclopedic and is not a dictionary entry or dictionary-style.[100] A topic should also meet Wikipedia's standards of "notability",[101] which generally means that the topic must have been covered in mainstream media or major academic journal sources that are independent of the article's subject. Further, Wikipedia intends to convey only knowledge that is already established and recognized.[102] It must not present original research. A claim that is likely to be challenged requires a reference to a reliable source. Among Wikipedia editors, this is often phrased as "verifiability, not truth" to express the idea that the readers, not the encyclopedia, are ultimately responsible for checking the truthfulness of the articles and making their own interpretations.[103] This can at times lead to the removal of information that, though valid, is not properly sourced.[104] Finally, Wikipedia must not take sides.[105]

Governance

Further information: Wikipedia:Administration

Wikipedia's initial anarchy integrated democratic and hierarchical elements over time.[106][107] An article is not considered to be owned by its creator or any other editor, nor by the subject of the article.[108]

Administrators

Editors in good standing in the community can request extra user rights, granting them the technical ability to perform certain special actions. In particular, editors can choose to run for "adminship",[109][110] which includes the ability to delete pages or prevent them from being changed in cases of severe vandalism or editorial disputes. Administrators are not supposed to enjoy any special privilege in decision-making; instead, their powers are mostly limited to making edits that have project-wide effects and thus are disallowed to ordinary editors, and to implement restrictions intended to prevent disruptive editors from making unproductive edits.[111][112]

By 2012, fewer editors were becoming administrators compared to Wikipedia's earlier years, in part because the process of vetting potential administrators had become more rigorous.[113]

Dispute resolution

Over time, Wikipedia has developed a semiformal dispute resolution process. To determine community consensus, editors can raise issues at appropriate community forums,[note 5] seek outside input through third opinion requests, or initiate a more general community discussion known as a "request for comment".

Arbitration Committee

Main article: Arbitration Committee

The Arbitration Committee presides over the ultimate dispute resolution process. Although disputes usually arise from a disagreement between two opposing views on how an article should read, the Arbitration Committee explicitly refuses to directly rule on the specific view that should be adopted. Statistical analyses suggest that the committee ignores the content of disputes and rather focuses on the way disputes are conducted,[114] functioning not so much to resolve disputes and make peace between conflicting editors, but to weed out problematic editors while allowing potentially productive editors back in to participate. Therefore, the committee does not dictate the content of articles, although it sometimes condemns content changes when it deems the new content violates Wikipedia policies (for example, if the new content is considered biased). Its remedies include cautions and probations (used in 63% of cases) and banning editors from articles (43%), subject matters (23%), or Wikipedia (16%).[when?] Complete bans from Wikipedia are generally limited to instances of impersonation and anti-social behavior. When conduct is not impersonation or anti-social, but rather anti-consensus or in violation of editing policies, remedies tend to be limited to warnings.[115]

Main article: Wikipedia community

Each article and each user of Wikipedia has an associated "talk" page. These form the primary communication channel for editors to discuss, coordinate and debate.[116]

Wikipedia's community has been described as cultlike,[117] although not always with entirely negative connotations.[118] Its preference for cohesiveness, even if it requires compromise that includes disregard of credentials, has been referred to as "anti-elitism".[119]

Wikipedians sometimes award one another "virtual barnstars" for good work. These personalized tokens of appreciation reveal a wide range of valued work extending far beyond simple editing to include social support, administrative actions, and types of articulation work.[120]

Wikipedia does not require that its editors and contributors provide identification.[121] As Wikipedia grew, "Who writes Wikipedia?" became one of the questions frequently asked there.[122] Jimmy Wales once argued that only "a community . a dedicated group of a few hundred volunteers" makes the bulk of contributions to Wikipedia and that the project is therefore "much like any traditional organization".[123] In 2008, a Slate magazine article reported that: "According to researchers in Palo Alto, one percent of Wikipedia users are responsible for about half of the site's edits."[124] This method of evaluating contributions was later disputed by Aaron Swartz, who noted that several articles he sampled had large portions of their content (measured by number of characters) contributed by users with low edit counts.[125]

The English Wikipedia has 6,410,280 articles, 42,573,941 registered editors, and 125,342 active editors. An editor is considered active if they have made one or more edits in the past 30 days.

Editors who fail to comply with Wikipedia cultural rituals, such as signing talk page comments, may implicitly signal that they are Wikipedia outsiders, increasing the odds that Wikipedia insiders may target or discount their contributions. Becoming a Wikipedia insider involves non-trivial costs: the contributor is expected to learn Wikipedia-specific technological codes, submit to a sometimes convoluted dispute resolution process, and learn a "baffling culture rich with in-jokes and insider references".[126] Editors who do not log in are in some sense second-class citizens on Wikipedia,[126] as "participants are accredited by members of the wiki community, who have a vested interest in preserving the quality of the work product, on the basis of their ongoing participation",[127] but the contribution histories of anonymous unregistered editors recognized only by their IP addresses cannot be attributed to a particular editor with certainty.

Studies

A 2007 study by researchers from Dartmouth College found that "anonymous and infrequent contributors to Wikipedia . are as reliable a source of knowledge as those contributors who register with the site".[128] Jimmy Wales stated in 2009 that "[I]t turns out over 50% of all the edits are done by just .7% of the users . 524 people . And in fact, the most active 2%, which is 1400 people, have done 73.4% of all the edits."[123] However, Business Insider editor and journalist Henry Blodget showed in 2009 that in a random sample of articles, most Wikipedia content (measured by the amount of contributed text that survives to the latest sampled edit) is created by "outsiders", while most editing and formatting is done by "insiders".[123]

A 2008 study found that Wikipedians were less agreeable, open, and conscientious than others,[129][130] although a later commentary pointed out serious flaws, including that the data showed higher openness and that the differences with the control group and the samples were small.[131] According to a 2009 study, there is "evidence of growing resistance from the Wikipedia community to new content".[132]

Diversity

Several studies have shown that most Wikipedia contributors are male. Notably, the results of a Wikimedia Foundation survey in 2008 showed that only 13 percent of Wikipedia editors were female.[133] Because of this, universities throughout the United States tried to encourage women to become Wikipedia contributors. Similarly, many of these universities, including Yale and Brown, gave college credit to students who create or edit an article relating to women in science or technology.[134]Andrew Lih, a professor and scientist, wrote in The New York Times that the reason he thought the number of male contributors outnumbered the number of females so greatly was because identifying as a woman may expose oneself to "ugly, intimidating behavior".[135] Data has shown that Africans are underrepresented among Wikipedia editors.[136]

Language editions

Main article: List of Wikipedias

Most popular edition of Wikipedia by country in January 2021.
Most viewed editions of Wikipedia over time.
Most edited editions of Wikipedia over time.

There are currently 325 language editions of Wikipedia (also called language versions, or simply Wikipedias). As of November 2021, the six largest, in order of article count, are the English, Cebuano, Swedish, German, French, and Dutch Wikipedias.[138] The second and third-largest Wikipedias owe their position to the article-creating botLsjbot, which as of 2013[update] had created about half the articles on the Swedish Wikipedia, and most of the articles in the Cebuano and Waray Wikipedias. The latter are both languages of the Philippines.

In addition to the top six, twelve other Wikipedias have more than a million articles each (Russian, Spanish, Italian, Polish, Egyptian Arabic, Japanese, Vietnamese, Waray, Chinese, Arabic, Ukrainian and Portuguese), seven more have over 500,000 articles (Persian, Catalan, Serbian, Indonesian, Norwegian, Korean and Finnish), 44 more have over 100,000, and 82 more have over 10,000.[139][138] The largest, the English Wikipedia, has over 6.4 million articles. As of January 2021,[update] the English Wikipedia receives 48% of Wikipedia's cumulative traffic, with the remaining split among the other languages. The top 10 editions represent approximately 85% of the total traffic.[140]

0.1 0.3 1 3

English 6,410,280

Cebuano 6,061,619

Swedish 2,872,837

German 2,633,512

French 2,374,985

Dutch 2,071,672

Russian 1,771,487

Spanish 1,731,929

Italian 1,726,585

Polish 1,496,935

Egyptian Arabic 1,378,106

Japanese 1,301,041

Vietnamese 1,270,100

Waray 1,265,576

Chinese 1,241,658

Arabic 1,143,507

Ukrainian 1,123,328

Portuguese 1,077,410

Persian 846,692

Catalan 689,830

The unit for the numbers in bars is articles.

Since Wikipedia is based on the Web and therefore worldwide, contributors to the same language edition may use different dialects or may come from different countries (as is the case for the English edition). These differences may lead to some conflicts over spelling differences (e.g. colour versus color)[142] or points of view.[143]

Though the various language editions are held to global policies such as "neutral point of view", they diverge on some points of policy and practice, most notably on whether images that are not licensed freely may be used under a claim of fair use.[144][145][146]

Jimmy Wales has described Wikipedia as "an effort to create and distribute a free encyclopedia of the highest possible quality to every single person on the planet in their own language".[147] Though each language edition functions more or less independently, some efforts are made to supervise them all. They are coordinated in part by Meta-Wiki, the Wikimedia Foundation's wiki devoted to maintaining all its projects (Wikipedia and others).[148] For instance, Meta-Wiki provides important statistics on all language editions of Wikipedia,[149] and it maintains a list of articles every Wikipedia should have.[150] The list concerns basic content by subject: biography, history, geography, society, culture, science, technology, and mathematics. It is not rare for articles strongly related to a particular language not to have counterparts in another edition. For example, articles about small towns in the United States might be available only in English, even when they meet the notability criteria of other language Wikipedia projects.

Estimation of contributions shares from different regions in the world to different Wikipedia editions[151]

Translated articles represent only a small portion of articles in most editions, in part because those editions do not allow fully automated translation of articles. Articles available in more than one language may offer "interwiki links", which link to the counterpart articles in other editions.[citation needed]

A study published by PLOS One in 2012 also estimated the share of contributions to different editions of Wikipedia from different regions of the world. It reported that the proportion of the edits made from North America was 51% for the English Wikipedia, and 25% for the simple English Wikipedia.[151]

English Wikipedia editor numbers

Number of editors on the English Wikipedia over time.

On March 1, 2014, The Economist, in an article titled "The Future of Wikipedia", cited a trend analysis concerning data published by the Wikimedia Foundation stating that "[t]he number of editors for the English-language version has fallen by a third in seven years."[152] The attrition rate for active editors in English Wikipedia was cited by The Economist as substantially in contrast to statistics for Wikipedia in other languages (non-English Wikipedia). The Economist reported that the number of contributors with an average of five or more edits per month was relatively constant since 2008 for Wikipedia in other languages at approximately 42,000 editors within narrow seasonal variances of about 2,000 editors up or down. The number of active editors in English Wikipedia, by sharp comparison, was cited as peaking in 2007 at approximately 50,000 and dropping to 30,000 by the start of 2014.

In contrast, the trend analysis published in The Economist presents Wikipedia in other languages (non-English Wikipedia) as successful in retaining their active editors on a renewable and sustained basis, with their numbers remaining relatively constant at approximately 42,000.[152] No comment was made concerning which of the differentiated edit policy standards from Wikipedia in other languages (non-English Wikipedia) would provide a possible alternative to English Wikipedia for effectively ameliorating substantial editor attrition rates on the English-language Wikipedia.[153]

Reception

See also: Academic studies about Wikipedia and Criticism of Wikipedia

Ambox current red Americas.svg

This section needs to be updated. Please help update this article to reflect recent events or newly available information.(March 2018)

Various Wikipedians have criticized Wikipedia's large and growing regulation, which includes more than fifty policies and nearly 150,000 words as of 2014.[update][154][155]

Critics have stated that Wikipedia exhibits systemic bias. In 2010, columnist and journalist Edwin Black described Wikipedia as being a mixture of "truth, half-truth, and some falsehoods".[156] Articles in The Chronicle of Higher Education and The Journal of Academic Librarianship have criticized Wikipedia's "Undue Weight" policy, concluding that the fact that Wikipedia explicitly is not designed to provide correct information about a subject, but rather focus on all the major viewpoints on the subject, give less attention to minor ones, and creates omissions that can lead to false beliefs based on incomplete information.[157][158][159]

Journalists Oliver Kamm and Edwin Black alleged (in 2010 and 2011 respectively) that articles are dominated by the loudest and most persistent voices, usually by a group with flowjo alternatives - Free Activators "ax to grind" on the topic.[156][160] A 2008 article in Education Next Journal concluded that as a resource about controversial topics, Wikipedia is subject to manipulation and spin.[161]

In 2020, Omer Benjakob and Stephen Harrison noted that "Media coverage of Wikipedia has radically shifted over the past two decades: once cast as an intellectual frivolity, it is now lauded as the 'last bastion of shared reality' online."[162]

In 2006, the Wikipedia Watch criticism website listed dozens of examples of plagiarism in the English Wikipedia.[163]

Accuracy of content

Main article: Reliability of Wikipedia

Articles for traditional encyclopedias such as Encyclopædia Britannica are written by experts, lending such encyclopedias a reputation for accuracy.[164] However, a peer review in 2005 of forty-two scientific entries on both Wikipedia and Encyclopædia Britannica by the science journal Nature found few differences in accuracy, and concluded that "the average science entry in Wikipedia contained around four inaccuracies; Britannica, about three."[165] Joseph Reagle suggested that while the study reflects "a topical strength of Wikipedia contributors" in science articles, "Wikipedia may not have fared so well using a random sampling of articles or on humanities subjects."[166] Others raised similar critiques.[167] The findings by Nature were disputed by Encyclopædia Britannica,[168][169] and in response, Nature gave a rebuttal of the points raised by Britannica.[170] In addition to the point-for-point disagreement between these two parties, others have examined the sample size and selection method used in the Nature effort, and suggested a "flawed study design" (in Nature's manual selection of articles, in part or in whole, for comparison), absence of statistical analysis (e.g., of reported confidence intervals), and a lack of study "statistical power" (i.e., owing to small sample size, 42 or 4 × 101 articles compared, vs >105 and >106 set sizes for Britannica and the English Wikipedia, respectively).[171]

As a consequence of the open structure, Wikipedia "makes no guarantee of validity" of its content, since no one is ultimately responsible for any claims appearing in it.[172] Concerns have been raised by PC World in 2009 regarding the lack of accountability that results from users' anonymity,[173] the insertion of false information,[174]vandalism, and similar problems.

Economist Tyler Cowen wrote: "If I had to guess whether Wikipedia or the median refereed journal article on economics was more likely to be true after a not so long think I would opt for Wikipedia." He comments that some traditional sources of non-fiction suffer from systemic biases, and novel results, in his opinion, are over-reported in journal articles as well as relevant information being omitted from news reports. However, he also cautions that errors are frequently found on Internet sites and that academics and experts must be vigilant in correcting them.[175]Amy Bruckman has argued that, due to the number of reviewers, "the content of a popular Wikipedia page is actually the most reliable form of information ever created".[176]

Critics argue that Wikipedia's open nature and a lack of proper sources for most of the information makes it unreliable.[177] Some commentators suggest that Wikipedia may be reliable, but that the reliability of any given article is not clear.[178] Editors of traditional reference works such as the Encyclopædia Britannica have questioned the project's utility and status as an encyclopedia.[179] Wikipedia co-founder Jimmy Wales has claimed that Wikipedia has largely avoided the problem of "fake news" because the Wikipedia community regularly debates the quality of sources in anime studio pro crack open structure inherently makes it an easy target for Internet trolls, spammers, and various forms of paid advocacy seen as counterproductive to the maintenance of a neutral and verifiable online encyclopedia.[80][182] In response to paid advocacy editing and undisclosed editing issues, Wikipedia was reported in an article in The Wall Street Journal, to have strengthened its rules and laws against undisclosed editing.[183] The article stated that: "Beginning Monday [from the date of the article, June 16, 2014], changes in Wikipedia's terms of use will require anyone paid to edit articles to disclose that arrangement. Katherine Maher, the nonprofit Wikimedia Foundation's chief communications officer, said the changes address a sentiment among volunteer editors that, 'we're not an advertising service; we're an encyclopedia.'"[183][184][185][186][187] These issues, among others, had been parodied since the first decade of Wikipedia, notably by Stephen Colbert on The Colbert Report.[188]

A Harvard law textbook, Legal Research in a Nutshell (2011), cites Wikipedia as a "general source" that "can be a real boon" in "coming up to speed in the law governing a situation" and, "while not authoritative, can provide basic facts as well as leads to more in-depth resources".[189]

Discouragement in education

Ambox current red Americas.svg

This section needs to be updated. Please help update this article to reflect recent events or newly available information.(December 2020)

Most university lecturers discourage students from citing any encyclopedia in academic work, preferring primary sources;[190] some specifically prohibit Wikipedia citations. Wales stresses that encyclopedias of any type are not usually appropriate to use as citable sources, and should not be relied upon as authoritative.[193] Wales once (2006 or earlier) said he receives about ten emails weekly from students saying they got failing grades on papers because they cited Wikipedia; he told the students they got what they deserved. "For God's sake, you're in college; don't cite the encyclopedia," he said.[194]

In February 2007, an article in The Harvard Crimson newspaper reported that a few of the professors at Harvard University were including Wikipedia articles in their syllabi, although without realizing the articles might change.[195] In June fineprint license code - Free Activators, former president of the American Library AssociationMichael Gorman condemned Wikipedia, along with Google,[196] stating that academics who endorse the use of Wikipedia are "the intellectual equivalent of a dietitian who recommends a steady diet of Big Macs with everything".

In contrast, academic writing[clarification needed] in Wikipedia has evolved in recent years and has been found to increase student interest, personal connection to the product, creativity in material processing, and international collaboration in the learning process.[197]

Medical information

See also: Health information on Wikipedia

On March 5, 2014, Julie Beck writing for The Atlantic magazine in an article titled "Doctors' #1 Source for Healthcare Information: Wikipedia", stated that "Fifty percent of physicians look up conditions on the (Wikipedia) site, and some are editing articles themselves to improve the quality of available information."[198] Beck continued to detail in this article new programs of Amin Azzam at the University of San Francisco to offer medical school courses to medical students for learning to edit and improve Wikipedia articles on health-related issues, as well as internal quality control programs within Wikipedia organized by James Heilman to improve a group of 200 health-related articles of central medical importance up to Wikipedia's highest standard of articles using its Featured Article and Good Article peer-review evaluation process.[198] In a May 7, 2014, follow-up article in The Atlantic titled "Can Wikipedia Ever Be a Definitive Medical Text?", Julie Beck quotes WikiProject Medicine's James Heilman as stating: "Just because a reference is peer-reviewed doesn't mean it's a high-quality reference."[199] Beck added that: "Wikipedia has its own peer review process before articles can be classified as 'good' or 'featured'. Heilman, who has participated in that process before, says 'less than one percent' of Wikipedia's medical articles have passed."[199]

Quality of writing

Screenshot of English Wikipedia's article on Earth, a featured-class article

In a 2006 mention of Jimmy Wales, Time magazine stated that the policy of allowing anyone to edit had made Wikipedia the "biggest (and perhaps best) encyclopedia in the world".[200]

In 2008, researchers at Carnegie Mellon University found that the quality of a Wikipedia article would suffer rather than gain from adding more writers when the article lacked appropriate explicit or implicit coordination.[201] For instance, when contributors rewrite small portions of an entry rather than making full-length revisions, high- and low-quality content may be intermingled within an entry. Roy Rosenzweig, a history professor, stated that American National Biography Online outperformed Wikipedia in terms of its "clear and engaging prose", which, he said, was an important aspect of good historical writing.[202] Contrasting Wikipedia's treatment of Abraham Lincoln to that of Civil War historian James McPherson in American National Biography Online, he said that both were essentially accurate and covered the major episodes in Lincoln's life, but praised "McPherson's richer contextualization . his artful use of quotations to capture Lincoln's voice . and . his ability to convey a profound message in a handful of words." By contrast, he gives an example of Wikipedia's prose that he finds "both verbose and dull". Rosenzweig also criticized the "waffling—encouraged by the NPOV policy—[which] means that it is hard to discern any overall interpretive stance in Wikipedia history". While generally praising the article on William Clarke Quantrill, he quoted its conclusion as an example of such "waffling", which then stated: "Some historians . remember him as an opportunistic, bloodthirsty outlaw, while others continue to view him as a daring soldier and local folk hero."[202]

Other critics have made similar charges that, even if Wikipedia articles are factually accurate, they are often written in a poor, almost unreadable style. Frequent Wikipedia critic Andrew Orlowski commented, "Even when a Wikipedia entry is 100 percent factually correct, and those facts have been carefully chosen, it all too often reads as if it has been translated from one language to another then into a third, passing an illiterate translator at each stage."[203] A study of Wikipedia articles on cancer was conducted in 2010 by Yaacov Lawrence of the Kimmel Cancer Center at Thomas Jefferson University. The study was limited to those articles that could be found in the Physician Data Query and excluded those written at the "start" class or "stub" class level. Lawrence found the articles accurate but not very readable, and thought that "Wikipedia's lack of readability (to non-college readers) may reflect its varied origins and haphazard editing".[204]The Economist argued that better-written articles tend to be more reliable: "inelegant or ranting prose usually reflects muddled thoughts and incomplete information".[205]

Coverage of topics and systemic bias

See also: Notability in the English Wikipedia and Criticism of Wikipedia § Systemic bias in coverage

Ambox current red Americas.svg

Parts of this article (those related to d:Wikidata:Statistics/Wikipedia) need to be updated. Please help update this article to reflect recent events or newly available information.(March 2017)

Wikipedia seeks to create a summary of all human knowledge in the form of an online encyclopedia, with each topic covered encyclopedically in one article. Since it has terabytes of disk space, it can have far more topics than can be covered by any printed encyclopedia.[206] The exact degree and manner of coverage on Wikipedia is under constant review by its editors, and disagreements are not uncommon (see deletionism and inclusionism).[207][208] Wikipedia contains materials that some people may find objectionable, offensive, or pornographic. The "Wikipedia is not censored" policy has sometimes proved controversial: in 2008, Wikipedia rejected an online petition against the inclusion of images of Muhammad in the English edition of its Muhammad article, citing this policy. The presence of politically, religiously, and pornographically sensitive materials in Wikipedia has led to the censorship of Wikipedia by national authorities in China[209] and Pakistan,[210] amongst other countries.

A 2008 study conducted by researchers at Carnegie Mellon University and Palo Alto Research Center gave a distribution of topics as well as growth (from July 2006 to January 2008) in adobe 3d models field:[211]

  • Culture and Arts: 30% (210%)
  • Biographies and persons: 15% (97%)
  • Geography and places: 14% (52%)
  • Society and social sciences: 12% (83%)
  • History and events: 11% (143%)
  • Natural and Physical Sciences: 9% (213%)
  • Technology and Applied Science: 4% (−6%)
  • Religions and belief systems: 2% (38%)
  • Health: 2% (42%)
  • Mathematics and logic: 1% (146%)
  • Thought and Philosophy: 1% (160%)

These numbers refer only to the number of articles: it is possible for one topic to contain a large number of short articles and another to contain a small number of large ones. Through its "Wikipedia Loves Libraries" program, Wikipedia has partnered with major public libraries such as the New York Public Library for the Performing Arts to expand its coverage of underrepresented subjects and articles.[212]

A 2011 study conducted by researchers at the University teracopy pro 2019 Minnesota indicated that male and female editors focus on different coverage topics. There was a greater concentration of females in the "people and arts" category, while males focus more on "geography and science".[213]

Coverage of topics and selection bias

Research conducted by Mark Graham of the Oxford Internet Institute in 2009 indicated that the geographic distribution of article topics is highly uneven. Africa is the most underrepresented.[214] Across 30 language editions of Wikipedia, historical articles and sections flowjo alternatives - Free Activators generally Eurocentric and focused on recent events.[215]

An editorial in The Guardian in 2014 claimed that more effort went into providing references for a list of female porn actors than a list of women writers.[216] Data has also shown that Africa-related material often faces omission; a knowledge gap that a July 2018 Wikimedia conference in Cape Town sought to address.[136]

Systemic biases

When multiple editors contribute to one topic or set of topics, systemic bias may arise, due to the demographic backgrounds of the editors. In 2011, Wales claimed that the unevenness of coverage is a reflection of the demography of the editors, citing for example "biographies of famous women through history and issues surrounding early childcare".[48] The October 22, 2013, essay by Tom Simonite in MIT's Technology Review titled "The Decline of Wikipedia" discussed the effect of systemic bias and policy creep on the downward trend in the number of editors.[49]

Systemic bias on Wikipedia may follow that of culture generally,[vague] for example favoring certain nationalities, ethnicities or majority religions.[217] It may more specifically follow the biases of Internet culture, inclining to be young, male, English-speaking, educated, technologically aware, and wealthy enough to spare time for editing. Biases, intrinsically, may include an overemphasis on topics such as pop culture, technology, and current events.[217]

Taha Yasseri of the University of Oxford, in 2013, studied the statistical trends of systemic bias at Wikipedia introduced by editing conflicts and their resolution.[218][219] His research examined the counterproductive work behavior of edit warring. Yasseri contended that simple reverts or "undo" operations were not the most significant measure of counterproductive behavior at Wikipedia and relied instead on the statistical measurement of detecting "reverting/reverted pairs" or "mutually reverting edit pairs". Such a "mutually reverting edit pair" is defined where one editor reverts the edit of another editor who then, in sequence, returns to revert the first editor in the "mutually reverting edit pairs". The results were tabulated for several language versions of Wikipedia. The English Wikipedia's three largest conflict rates belonged to the articles George W. Bush, anarchism, and Muhammad.[219] By comparison, for the German Wikipedia, the three largest conflict rates at the time of the Oxford study were for the articles covering Croatia, Scientology, and 9/11 conspiracy theories.[219]

Researchers from Washington University developed a statistical model to measure systematic bias in the behavior of Wikipedia's users regarding controversial topics. The authors focused on behavioral changes of the encyclopedia's administrators after assuming the post, writing that systematic bias occurred after the fact.[220][221]

Explicit content

See also: Internet Watch Foundation and Wikipedia and Reporting of child pornography images on Wikimedia Commons

"Wikipedia censorship" redirects here. For the government censorship of Wikipedia, see Censorship of Wikipedia. For Wikipedia's policy concerning censorship, see Wikipedia:Wikipedia is not censored

Wikipedia has been criticized for allowing information about graphic content. Articles depicting what some critics have called objectionable content (such as feces, cadaver, human penis, vulva, and nudity) contain graphic pictures and detailed information easily zoom cracked version - Free Activators to anyone with access to the internet, including children.

The site also includes sexual content such as images and videos of masturbation and ejaculation, illustrations of zoophilia, and photos from hardcore pornographic films in its articles. It also has non-sexual photographs of nude children.

The Wikipedia article about Virgin Killer—a 1976 album from the GermanrockbandScorpions—features a picture of the album's original cover, which depicts a naked prepubescent girl. The original release cover caused controversy and was replaced in some countries. In December 2008, access to the Wikipedia article Virgin Killer was blocked for four days by most Internet service providers in the United Kingdom after the Internet Watch Foundation (IWF) decided the album cover was a potentially illegal indecent image and added the article's URL to a "blacklist" it supplies to British internet service providers.[222]

In April 2010, Sanger wrote a letter to the Federal Bureau of Investigation, outlining his concerns that two categories of images on Wikimedia Commons contained child pornography, and were in violation of US federal obscenity law.[223][224] Sanger later clarified that the images, which were related to pedophilia and one about lolicon, were not of real children, but said that they constituted "obscene visual representations of the sexual abuse of children", under the PROTECT Act of 2003.[225] That law bans photographic child pornography and cartoon images and drawings of children that are obscene under American law.[225] Sanger also expressed concerns about access to the images on Wikipedia in schools.[226]Wikimedia Foundation spokesman Jay Walsh strongly rejected Sanger's accusation,[227] saying that Wikipedia did not have "material we would deem to be illegal. If we did, we would remove it."[227] Following the complaint by Sanger, Wales deleted sexual images without consulting the community. After some editors who volunteer to maintain the site argued that the decision to delete had been made hastily, Wales voluntarily gave up some of the powers he had held up to that time as part of his co-founder status. He wrote in a message to the Wikimedia Foundation mailing-list that this action was "in the interest of encouraging this discussion to be about real philosophical/content issues, rather than be about me and how quickly I acted".[228] Critics, including Wikipediocracy, noticed that many of the pornographic images deleted from Wikipedia since 2010 have reappeared.[229]

Privacy

One privacy concern in the case of Wikipedia is the right of a private citizen to remain a "private citizen" rather than a "public figure" in the eyes of the law.[230][note 6] It is a battle between the right to be anonymous in cyberspace and the right to be anonymous in real life ("meatspace"). A particular problem occurs in the case of a relatively unimportant individual and for whom there exists a Wikipedia page against her or his wishes.

In January 2006, a German court ordered the German Wikipedia shut down within Germany because it stated the full name of Boris Floricic, aka "Tron", a deceased hacker. On February 9, 2006, the injunction against Wikimedia Deutschland was overturned, with the court rejecting the notion that Tron's right to privacy or that of his parents was being violated.[231]

Wikipedia has a "Volunteer Response Team" that uses Znuny, a free and open-source software fork of OTRS[232] to handle queries without having to reveal the identities of the involved parties. This is used, for example, in confirming the permission for using individual images and other media in the project.[233]

Sexism

Main article: Gender bias on Wikipedia

Wikipedia was described in 2015 as harboring a battleground culture of sexism and harassment.[234][235]

The perceived toxic attitudes and tolerance of violent and abusive language were reasons put forth in 2013 for the gender gap in Wikipedia editorship.[236]

Edit-a-thons have been held to encourage female editors and increase the coverage of women's topics.[237]

A comprehensive 2008 survey, published in 2016, found significant gender differences in: confidence in expertise, discomfort with editing, and response to critical feedback. "Women reported less confidence in their expertise, expressed greater discomfort with editing (which typically involves conflict), and reported more negative responses to critical feedback compared to men."[238]

Operation

Wikimedia Foundation and Wikimedia movement affiliates

Main article: Wikimedia Foundation

Wikipedia is hosted and funded by the Wikimedia Foundation, a non-profit organization which also operates Wikipedia-related projects such as Wiktionary and Wikibooks. The foundation relies on public contributions and grants to fund its mission.[239] The foundation's 2013 IRS Form 990 shows revenue of $39.7 million and expenses of almost $29 million, with assets of $37.2 million and liabilities of about $2.3 million.[240]

In May 2014, Wikimedia Foundation named Lila Tretikov as its second executive director, taking over for Sue Gardner.[241] The Wall Street Journal reported on May 1, 2014, that Tretikov's information technology background from her years at University of California offers Wikipedia an opportunity to develop in more concentrated directions guided by her often repeated position statement that, "Information, like air, wants to be free."[242][243] The same Wall Street Journal article reported these directions of development according to an interview with spokesman Jay Walsh of Wikimedia, who "said Tretikov would address that issue (paid advocacy) as a priority. 'We are really pushing toward more transparency . We are reinforcing that paid advocacy is not welcome.' Initiatives to involve greater diversity of contributors, better mobile support of Wikipedia, new geo-location tools to find local content more easily, and more tools for users in the second and third world are also priorities," Walsh said.[242]

Following the departure of Tretikov from Wikipedia due to issues concerning the use of the "superprotection" feature which some language versions of Wikipedia have adopted, Katherine Maher became the third executive director of the Wikimedia Foundation in June 2016.[244] Maher has stated that one of her priorities would be the issue of editor harassment endemic to Wikipedia as identified by the Wikipedia board in December. Maher stated regarding the harassment issue that: "It establishes a sense within the community that this is a priority . (and that correction requires that) it has to be more than words."[245]

Wikipedia is also supported by many organizations and groups that are affiliated with the Wikimedia Foundation but independently-run, called Wikimedia movement affiliates. These include Wikimedia chapters (which are national or Reimage PC Repair 2021 Crack - Free Activators organizations, such as Wikimedia Deutschland and Wikimédia France), thematic organizations (such as Amical Wikimedia for the Catalan language community), and user groups. These affiliates participate in the promotion, development, and funding of Wikipedia.

Software operations and support

See also: MediaWiki

The operation of Wikipedia depends on MediaWiki, a custom-made, free and open sourcewiki software platform written in PHP and built upon the MySQL database system.[246] The software incorporates programming features such as a macro language, variables, a transclusion system for templates, and URL redirection. MediaWiki is licensed under the GNU General Public License (GPL) and it is used by all Wikimedia projects, as well as many other wiki projects. Originally, Wikipedia ran on UseModWiki written in Perl by Clifford Adams (Phase I), which initially required CamelCase for article hyperlinks; the present double bracket style was incorporated later. Starting in January 2002 (Phase II), Wikipedia began running on a PHP wiki engine with a MySQL database; this software was custom-made for Wikipedia by Magnus Manske. The Phase II software was repeatedly modified to accommodate the exponentially increasing demand. In July 2002 (Phase III), Wikipedia shifted to the third-generation software, MediaWiki, originally written by Lee Daniel Crocker.

Several MediaWiki extensions are installed[247] to extend the functionality of the MediaWiki software.

In April 2005, a Lucene extension[248][249] was added to MediaWiki's built-in search and Wikipedia switched from MySQL to Lucene for searching. Lucene was later replaced by CirrusSearch which is based on Elasticsearch.[250]

In July 2013, after extensive beta testing, a WYSIWYG (What You See Is What You Get) extension, VisualEditor, was opened to public use.[251][252][253][254] It was met with much rejection and criticism, and was described as "slow and buggy".[255] The feature was changed from opt-out to opt-in afterward.

Automated editing

Main article: Wikipedia bots

Computer programs called bots have often been used to perform simple and repetitive tasks, such as correcting common misspellings and stylistic issues, or to start articles such as geography entries in a standard format from statistical data.[256][257][258] One controversial contributor, Sverker Johansson, creating articles with his bot was reported to create up to 10,000 articles on the Swedish Wikipedia on certain days.[259] Additionally, there are bots designed to automatically notify editors when they make common editing errors (such as unmatched quotes or unmatched parentheses).[260] Edits falsely identified by bots as the work of a banned editor can be restored by other editors. An anti-vandal bot is programmed to detect and revert vandalism quickly.[257] Bots are able to indicate edits from particular accounts or IP address ranges, as occurred at the time of the shooting down of the MH17 jet incident in July 2014 when it was reported that edits were made via IPs controlled by the Russian government.[261] Bots on Wikipedia must be approved before activation.[262]

According to Andrew Lih, the current expansion of Wikipedia to millions of articles would be difficult to envision without the use of such bots.[263]

Hardware operations and support

See also: Wikimedia Foundation § Hardware

Wikipedia receives between 25,000 and 60,000-page requests per second, depending on the time of the day.[264][needs update] As of 2021,[update] page requests are first passed to a front-end layer of Varnish

Источник: https://en.wikipedia.org/wiki/Wikipedia

Abstract

IL-6 plays an important role in determining the fate of effector CD4 cells and the cytokines that these cells produce. Here we identify a novel molecular mechanism by which IL-6 regulates CD4 cell effector function. We show that IL-6-dependent signal facilitates the formation of mitochondrial respiratory chain supercomplexes to sustain high mitochondrial membrane potential late during activation of CD4 cells. Mitochondrial hyperpolarization caused by IL-6 is uncoupled from the production of ATP by oxidative phosphorylation. However, it is a mechanism to raise the levels of mitochondrial Ca2+ late during activation of CD4 cells. Increased levels of mitochondrial Ca2+ in the presence of IL-6 are used to prolong Il4 and Il21 expression in effector CD4 cells. Thus, the effect of IL-6 on mitochondrial membrane potential and mitochondrial Ca2+ is an alternative pathway by which IL-6 regulates effector function of CD4 cells and it could contribute to the pathogenesis of inflammatory diseases.

https://doi.org/10.7554/eLife.06376.001

eLife digest

Inflammation is a normal part of the body's response to an infection or injury and it helps to start the healing process. However, if left unchecked, inflammation itself can damage tissues, and diseases such as rheumatoid arthritis are the result of uncontrolled inflammation.

Certain immune cells release molecules that can either trigger or suppress inflammation. Interleukin 6 is an example of a ‘pro-inflammatory’ molecule, which regulates the activity of groups of immune cells collectively known as ‘CD4 cells’. People who are overweight or obese have higher levels of interleukin 6 than people of a healthy weight. Obesity and other metabolic conditions have been linked to problems with structures called mitochondria, which make a molecule called ATP that provides cells with the energy they need to survive. But it is not known if interleukin 6 can affect the activity of mitochondria inside CD4 cells.

Now, Yang et al. have discovered that interleukin 6 can affect the mitochondria inside CD4 cells and, in doing so, have identified a new way that interleukin 6 can regulate these cells' activity. Experiments involving immune cells from mice revealed that interleukin 6 triggers a cascade of signaling events that aid the formation of so-called ‘mitochondrial respiratory chain supercomplexes’ in CD4 cells. These are groups of proteins that work together in the membranes of mitochondria and are vital for the activity of these structures. The formation of these supercomplexes maintains a large voltage difference across the membrane of the mitochondria that occurs during the later stages of CD4 cell activation.

Yang et al. found that this voltage difference was not linked to the production of ATP, but that it did raise the levels of calcium ions inside the mitochondria. Further experiments revealed that these increased levels of calcium ions prolong the production of other pro-inflammatory molecules in the CD4 cells.

Following the discovery of a new pathway that regulates the activity of CD4 cells, the next challenge is to see if the parts of this pathway could be targeted with drugs to help treat inflammatory diseases such as rheumatoid arthritis. Moreover, because interleukin 6 plays an active role in other diseases such as cancer, further studies of this new pathway may help explain how this molecule encourages cancers to progress and/or spread around the body.

https://doi.org/10.7554/eLife.06376.002

Introduction

Interleukin 6 (IL-6) is an inflammatory cytokine that is elevated in several autoimmune and inflammatory disorders, including rheumatoid arthritis (RA) (Kishimoto, 2005). Inhibition of IL-6 signaling by an anti-IL-6R antibody has been shown to be a highly effective therapy in treating patients with RA (Tanaka and Kishimoto, 2012). IL-6 plays crucial role in regulating CD4 T helper cell differentiation and cytokine production (Dienz and Rincon, 2009). It enhances Th2 differentiation through an auto-feedback loop by upregulating autocrine IL-4 production (Rincon et al., 1997; Diehl et al., 2002). IL-6 inhibits IFNγ production and Th1 differentiation (Diehl et al., 2000). In combination with TGFβ, IL-6 also contributes to the differentiation of Th17 cells (Bettelli et al., 2006; Ivanov et al., 2006; Zhou et al., 2007). IL-6 inhibits regulatory T cell function and downregulates Foxp3 expression (Pasare and Medzhitov, 2003; Dienz and Rincon, 2009). In addition, IL-6 alone, without the need of TGFβ, induces IL-21 expression, a mechanism by which it promotes the generation of follicular T helper (Tfh) cells (Nurieva et al., 2008; Suto et al., 2008; Dienz et al., 2009; Diehl et al., 2012).

IL-6 binds to its membrane receptor, which triggers signaling through gp130, a common transducer that activates Jak/Stat3 and Ras/MAPK pathways in T cells (Boulanger et al., 2003; Heinrich et al., 2003; Kishimoto, 2005). Stat3 is a transcription factor present in cytosol but translocates to the nucleus upon stimulation where it mediates the expression of numerous genes. Stat3 has been previously implicated in the regulation of genes involved in cell survival and proliferation by directly binding to multiple survival genes, including Bcl2, Fos, Jun, Mcl1 and Fosl2 (Hirano et al., 2000; Bourillot et al., 2009; Durant et al., 2010; Carpenter and Lo, 2014). Additionally, IL-6-dependent Stat3 activation plays an important role in the expression of several cytokine genes, including Il21 and Il17 (Mathur et al., 2007; Zhou et al., 2007; Dienz et al., 2009). In addition to its role as a nuclear transcription factor, Stat3 has been found within mitochondria in liver, heart and some cell lines where it enhances the mitochondrial respiratory chain activity (Gough et al., 2009; Wegrzyn et al., 2009). However, no studies have addressed whether IL-6 regulates mitochondrial function through Stat3.

IL-6 has for long been associated with metabolic changes and high levels of IL-6 in serum have been correlated with BMI (Mohamed-Ali et al., 1997; Fried et al., 1998; Vgontzas et al., 2000). Recent studies indicate that IL-6 is linked to glucose homeostasis in adipose tissue and it participates in the switch from white to brown fat tissue in cancer-induced cachexia (Stanford et al., 2013; Petruzzelli et al., 2014). However, it remains unclear whether IL-6 has a direct effect on the metabolism of cells. But in the context of ischemia-reperfusion injury in cardiomyocytes, IL-6 has been shown to maintain mitochondrial membrane potential (MMP) in cardiomyocytes (Smart et al., 2006). Despite the known role of IL-6 in the CD4 cell effector function, no studies have addressed whether IL-6 has an effect on mitochondrial function in CD4 cells.

Here we show that IL-6 plays an important role in maintaining MMP late during CD4 cell activation in a Stat3-dependent manner. IL-6-mediated mitochondrial hyperpolarization is, however, uncoupled from the oxidative phosphorylation and ATP production. Instead, IL-6 uses the high MMP to raise mitochondrial Ca2+ and, consequently, cytosolic Ca2+ levels to promote cytokine expression late during activation. Thus we have identified a previously undescribed mechanism by which IL-6 regulates CD4 cell effector function.

Results

IL-6 is essential to sustain MMP during activation of CD4 cells

Although the role of IL-6 in CD4 cell differentiation and cytokine gene expression is well established, little is known about the role of this cytokine in mitochondrial function. An essential function of the mitochondrial electron transport chain (ETC), in addition to the transfer of electrons, is the generation of an electrochemical gradient across the mitochondrial inner membrane by accumulating H+ at the intermembrane space. This electrochemical gradient, known as MMP, is used as a mechanism to generate ATP. Since IL-6 has been associated with maintaining MMP in cardiomyocytes (Smart et al., 2006), we examined whether IL-6 regulates the MMP in CD4 cells during activation. Fresh CD4 cells were activated with anti-CD3 and anti-CD28 antibodies (Abs) in the presence or absence of IL-6 for different periods of times, stained with TMRE (an MMP indicator), and analyzed by flow cytometry. Most freshly isolated CD4 cells were hyperpolarized as shown by the high TMRE staining (Figure 1A). However, cells activated in the absence of IL-6 depolarized progressively during activation (Figure 1A). Interestingly, the presence of IL-6 prevents mitochondrial depolarization during CD4 cell activation (Figure 1A). After 48hr of activation, most CD4 cells activated in the presence of IL-6 maintained a high MMP (TMREhigh) (Figure 1B). In contrast to IL-6, the presence of exogenous IL-2, the main growth factor of T cells, did not affect MMP in activated CD4 cells (Figure 1C), supporting a selective role for IL-6 on MMP.

To examine the effect of IL-6 on mitochondrial mass and levels of ETC complexes, we performed Western blot analysis for subunits of these complexes using whole cell extracts. IL-6 did not affect the overall mitochondrial mass as determined by the levels of COX IV (Complex IV subunit of ETC), NDUFS3 and NDUFA9 (Complex I subunits) (Figure 1D). In addition, the frequency of live cells among those activated in the presence of IL-6 was not significantly different from the frequency of live cells in the absence of IL-6 (Figure 1E). Thus, the increase of MMP triggered by IL-6 is not a consequence of survival or change in mitochondrial mass.

Antigen presenting cells (APCs) are one of the major sources of IL-6 during CD4 cell activation. To examine whether IL-6 was required to maintain the mitochondrial hyperpolarization during antigen activation, naive CD4 cells were obtained from OT-II TCR transgenic mice (Barnden et al., 1998) and activated with OVA peptide and APCs isolated from WT or IL-6 KO mice. Similar to CD4 cells activated with anti-CD3/CD28 Abs in the presence of IL-6, a large frequency of OT-II CD4 cells activated with WT APC showed a high MMP (Figure 1F,G). However, a blocking anti-IL-6 Ab drastically decreased the frequency of cells with high MMP (Figure 1F,G). In contrast to WT APCs, very low frequency of activated CD4 cells showed high MMP when APC from IL-6 KO mice were used (Figure 1F,G). Remarkably, addition of exogenous IL-6 to cells activated with IL-6 KO APCs restored high MMP (Figure 1F,G). Thus, these results indicate that IL-6 derived from APC during in vitro activation of CD4 cells is essential to maintain mitochondrial hyperpolarization.

To address the role of IL-6 in regulating the MMP in CD4 cells during in vivo activation, we performed adoptive transfer of OT-II CD4 cells into WT or IL-6 KO mice as hosts. Mice were then immunized with ovalbumin, and after two days, cells were harvested to examine their MMP. Similar to in vitro results, the fraction of OT-II cells maintaining a high MMP was significantly greater in WT mice relative to IL-6 KO mice (Figure 1H). Together, these results indicate that IL-6 plays an essential role in maintaining the MMP during activation of CD4 cells.

IL-6 facilitates the formation of respiratory chain supercomplexes in CD4 cells during activation

Morphological states of highly pleomorphic inner membrane cristae reflect the different mitochondrial metabolic stages. Mitochondrial cristae shape has been shown to influence the efficiency of the respiratory chain in part by affecting the formation of respiratory chain supercomplexes (RCS) (Hackenbrock, 1966; Gomes et al., 2011; Cogliati et al., 2013), formed of Complex I together with Complex III and Complex IV. The function of RCS is to facilitate the transfer of electrons between complexes and increase Complex I activity while reducing the electron leak from ETC and mitigate the production of reactive oxygen species (ROS) (Schägger, 1995; Acín-Pérez et al., 2008; Althoff et al., 2011; Winge, 2012). To determine whether IL-6 could affect cristae shape, we examined CD4 cells activated in the presence or absence of IL-6 by transmission electron microscopy (TEM) imaging. No obvious differences in mitochondrial integrity or mitochondrial mass were observed in cells activated with or without IL-6 (Figure 2A). Similarly, there was no increase in the number of mitochondria in CD4 cells activated in the presence of IL-6 (Figure 2—figure supplement 1). However, the morphology of the mitochondrial cristae in cells activated with IL-6 was different from that of cells activated without IL-6 (Figure 2A). The number of mitochondria with expanded and disorganized cristae was greater in CD4 cells activated in the absence of IL-6 compared with CD4 cells activated with IL-6 (Figure 2B). In contrast, the number of mitochondria with tight and organized cristae was higher in cells activated in the presence of IL-6 (Figure 2C). Thus, IL-6 affects mitochondrial cristae shape during activation of CD4 cells.

To determine whether the effect of IL-6 on the mitochondrial cristae morphology could be reflected in an altered formation of RCS as a mechanism to maintain a high MMP, we examined the presence of RCS in activated CD4 cells. We performed blue-native gel electrophoresis (BN-PAGE) using mitochondrial extracts generated in the presence of digitonin to preserve the supercomplexes (SCs) (Acín-Pérez et al., 2008), followed by Western blot analysis. The levels of RCS but not the levels of individual Complex I or Complex III were increased in mitochondria from IL-6-stimulated CD4 cells, as determined by the presence of NDUFA9 (Complex I) and Core I (Complex III) within the RCS region (Figure 2D).

Since the formation of RCS is associated with increased MMP but reduced mitochondrial ROS (mROS) (Schägger, 1995; Acín-Pérez et al., 2008; Althoff et al., 2011; Winge, 2012), we examined the production of mROS in CD4 cells activated with or without IL-6 by flow cytometry analysis using MitoSOX, a mitochondrial superoxide indicator. Despite the increased MMP, IL-6 reduced the production of mROS (Figure 2E,F). Thus, the formation of RCS facilitated by IL-6 makes possible for this cytokine to sustain mitochondria hyperpolarization while minimizing the production of mROS during activation of CD4 cells.

IL-6-mediated mitochondrial hyperpolarization is uncoupled from OXPHOS

The energy released from the transport of H+ from the mitochondrial intermembrane space to the mitochondrial matrix through F0F1 ATP synthase, a subunit of Complex V, is coupled to ATP generation. Thus, an increased MMP elicited by IL-6 could potentially lead to an increase in mitochondrial ATP synthesis. We therefore examined ATP production in CD4 cells activated in the presence or absence of IL-6. Surprisingly, despite of the increased MMP, intracellular ATP levels were not affected by IL-6 (Figure 3A). TCR stimulation has been shown to trigger rapid ATP release from CD4 cells (Yip et al., 2009). It was therefore possible that IL-6 increased ATP synthesis but also ATP release. However, analysis of ATP levels in culture supernatants of activated cells showed no difference in the levels of extracellular ATP (Figure 3B). Since most ATP in activated T cells is generated through glycolysis (Pearce et al., 2013), increased MMP by IL-6 could enhance mitochondrial oxidative phosphorylation (OXPHOS) but have minimal effect on overall ATP levels. To further address the effect of IL-6 on mitochondrial OXPHOS, we examined oxygen consumption rate (OCR) using the Seahorse XF24 analyzer (Wu et al., 2007). No statistically significant difference in basal mitochondrial OCR or maximal respiratory capacity was detected (Figure 3C). Thus, the effects of IL-6 on the MMP are uncoupled from OXPHOS.

We also examined whether the mitochondrial hyperpolarization by IL-6 could compromise anaerobic glycolysis during activation. Culture supernatants of activated CD4 cells with or without IL-6 were assayed for lactate production. Lactate production was not significantly different in cells activated with IL-6 (Figure 3D). The Seahorse XF24 analyzer was also used to measure the extracellular acidification rate (ECAR), another alternative approach to examine the rate of glycolysis. Consistent with the production of lactate, there was no difference in anaerobic glycolysis in the presence of IL-6 during CD4 cell activation (Figure 3E). Thus, although IL-6 maintains high MMP late during the activation of CD4 cells, it does not alter rates of OXPHOS or anaerobic glycolysis.

IL-6-mediated high MMP results in elevated mitochondrial Ca2+ levels

Although the main function of the MMP is to drive the generation of ATP through OXPHOS, MMP also plays an important role in mitochondrial Ca2+ homeostasis (Rizzuto et al., 2012). Mitochondria are emerging as the primary subcellular Ca2+ store which buffers cytosolic Ca2+ (Starkov, 2010). Mitochondrial Ca2+ uptake is modulated by mitochondrial calcium uniporter (MCU) and it is dictated by the MMP (Baughman et al., 2011; De Stefani et al., 2011; Mallilankaraman et al., 2012a, 2012b; Shanmughapriya et al., 2015), while Ca2+ release from mitochondria is mediated by the mitochondrial Na+/Ca2+ exchanger (mNCLX) (Kirichok et al., 2004; Palty et al., 2010; Nita et al., 2012; Rizzuto et al., 2012). Upon TCR engaging, it has been reported that the formation of the immunological synapse triggers early store-dependent Ca2+ influx through mitochondrial Ca2+ buffering (Hoth et al., 1997; Quintana et al., 2007). However, little is known about the mitochondrial Ca2+ signaling in activated effector cells and how it may contribute to CD4 cell effector functions. We examined whether an increased MMP regulated by IL-6 could affect mitochondrial Ca2+ homeostasis. CD4 cells activated in the presence or absence of IL-6 for 48 hr were stained with Rhod-2 AM, a selective indicator for mitochondrial Ca2+ (Hajnoczky et al., 1995; Brisac et al., 2010) and analyzed by flow cytometry. Consistent with an increased MMP, there was a significantly greater frequency of cells with high levels of mitochondrial Ca2+ (Rhod-2high) in the presence of IL-6 (Figure 4A,C). Short treatment of IL-6-activated CD4 cells with the depolarizing agent Carbonyl cyanide m-chlorophenyl hydrazone (CCCP) significantly reduced the frequency of cells with high levels of mitochondrial Ca2+ (Rhod-2high) (Figure 4B,C), indicating that the increased levels of mitochondrial Ca2+ are dependent on mitochondrial hyperpolarization.

Because of their dynamic characteristics and ability to redistribute within the cell, mitochondria play an important role in cytoplasmic Ca2+ homeostasis. Mitochondria uptake Ca2+ through MCU at the cytoplasmic membrane near the extracellular calcium channels, as well as from ER storage, and serve as a delivery vehicle to increase cytosolic Ca2+ (Rizzuto et al., 2012; Soboloff et al., 2012). Thus, early during T cell activation mitochondria have been shown to relocate close to immune synapse and contribute to increase cytosolic Ca2+ (Quintana et al., 2007; Schwindling et al., 2010). To determine whether the increase in mitochondrial Ca2+ elicited by IL-6 could affect the levels of free cytosolic Ca2+, we examined the basal level of cytosolic Ca2+ in CD4 cells using Fura-2 AM as a calcium indicator. The levels of cytosolic Ca2+, as determined by fluorometric ratio at 340 nm/380 nm (F340/380), in cells activated with IL-6 were Movavi Video Converter 19.3.0 Crack Activation Key For Lifetime than in cells activated without IL-6 (Figure 4D). It has been previously shown that TCR stimulation fails to induce cytosolic Ca2+ flux in activated CD4 cells, as determined by flow cytometry analysis (Nagaleekar et al., 2008). Similarly, no Ca2+ flux was triggered by TCR stimulation in CD4 cells activated in the presence of IL-6 (data not shown). However, similar to the results with Fura-2 staining, analysis of the cytosolic Ca2+ baseline by Indo-1 staining and flow cytometry analysis also revealed higher baseline in CD4 cells activated in the presence of IL-6 relative to cells activated in the absence of IL-6 (Figure 4—figure supplement 1A). Maximum cytosolic Ca2+ levels triggered by the calcium ionophore, ionomycin were comparable between CD4 cells activated in the presence or absence of IL-6 (Figure 4—figure supplement 1A). Thus, the presence of IL-6 during activation maintains increased levels of cytosolic Ca2+.

To demonstrate that this increased cytosolic Ca2+ was dependent on high mitochondrial Ca2+, we examined the effect of CGP-37157, a blocker of mitochondrial Ca2+ efflux (Cox et al., 1993). As previously demonstrated (Delmotte et al., 2012), treatment with CGP-37157 resulted in increased levels of mitochondrial Ca2+ (Figure 4—figure supplement 1B). Importantly, the treatment with CGP-37157, lowered the cytosolic Ca2+ levels in CD4 cells activated in the presence of IL-6 to the levels found in those without IL-6 (Figure 4D), indicating that this increase was dependent on mitochondrial Ca2+. In addition, reducing the MMP in IL-6-stimulated cells by treatment with inhibitors of Complex I (rotenone) and Complex III (antimycin) also lowered the levels of cytosolic Ca2+ (Figure 4D). Similar effects were found by the treatment with CCCP (Figure 4—figure supplement 1C). IL-6 therefore provides a mechanism for CD4 cells to maintain elevated levels of cytosolic Ca2+ through its effect on the MMP and mitochondrial Ca2+.

The regulation of the MMP and mitochondrial Ca2+ elicited by IL-6 is Stat3 dependent

In addition to its role as a transcription factor, several studies have shown the presence of Stat3 in mitochondria where it regulates the ETC primarily in tissues with high mitochondria content (Gough et al., 2009; Wegrzyn et al., 2009; Heusch et al., 2011; Lachance et al., 2013; Zhang et al., 2013; Erlich et al., 2014). Although IL-6 is a major activator of Stat3, no studies have previous address the regulation of Stat3 in mitochondria by this cytokines. However, the maintenance of high MMP late during activation of CD4 cells by IL-6 could possibly be mediated by Stat3. We first examined whether Stat3 could also be present in mitochondria in activated CD4 cells by Western blot analysis using extracts from different subcellular fractions. As expected, Stat3 was present in both the nucleus and cytosol (Figure 5A). Interestingly, however, high levels of Stat3 were also present in mitochondria (Figure 5A). GAPDH and COX IV were used as cytosolic and mitochondrial fraction markers, respectively (Figure 5A). To examine whether localization of Stat3 in mitochondria was influenced by IL-6 during CD4 cell activation, we performed Western blot analysis using mitochondrial extracts from CD4 cells activated in the presence or absence of IL-6 as well as from freshly isolated CD4 cells. Only low levels of Stat3 were present in the mitochondrial fraction from freshly isolated CD4 cells (Figure 5B). High levels of Stat3 were detected in mitochondria from activated cells, but these levels were further upregulated by IL-6 (Figure 5B). In contrast, as a control, the levels of NDUFA9 were not affected by IL-6 (Figure 5B). IL-6 did not have an effect on the total levels of Stat3 either, as determined by Western-blot using whole cell lysates (Figure 5C). We also examined whether Stat3 in mitochondria was phosphorylated. No phospho-Stat3 was detected in mitochondria from freshly isolated CD4 cells (Figure 5B). Phospho-Stat3 was present in mitochondria of activated CD4 cells, but the levels were substantially higher in the presence of IL-6 (Figure 5B). Thus, IL-6 promotes the accumulation of Stat3 in mitochondria during CD4 cell activation.

We then investigated whether IL-6 increases MMP in activated CD4 cells through Stat3. CD4 cells from wild-type (Stat3+/+) mice and T-cell conditional Stat3 knockout (Stat3−/−) mice (Takeda et al., 1998) were activated in the absence or presence of IL-6, and MMP was examined 48 hr later. Interestingly, IL-6 failed to increase MMP in Stat3-deficient CD4 cells during activation (Figure 5D,E), indicating that effect of IL-6 on MMP in CD4 cells is dependent on Stat3. To address whether this effect of Stat3 dissociates from its activity as a transcription factor, we used CD4 cells from mice expressing a mutant Stat3 (mut-Stat3) carrying a deletion at V463 residue (Stat3-Δ463) that prevents DNA binding but does not affect Stat3 phosphorylation (Steward-Tharp et al., 2014). This mutation was found in autosomal dominant hyperimmunoglobulin E syndrome (Holland et al., 2007; Minegishi et al., 2007; Jiao et al., 2008). Expression of mut-Stat3 in mice has been shown to act as dominant-negative and inhibit Stat3 mediated transcription (Steward-Tharp et al., 2014). CD4 cells from WT and mut-Stat3 mice were activated with or without IL-6 and MMP was examined after 48 hr. IL-6 was still able to increase MMP in CD4 cells from mut-Stat3 mice (Figure 5F). In addition, we also tested the effect of Stattic, a well characterized inhibitor of Stat3 that blocks dimerization of Stat3 through phosphor-Tyr705 (Schust et al., 2006). The presence of Stattic, even at a relatively high concentration (Schust et al., 2006), did not affect the MMP in IL-6-treated CD4 cells (Figure 5—figure supplement 1A and B). Thus, correlating with the accumulation of Stat3 in mitochondria, the increased MMP in CD4 cells activated in the presence of IL-6 requires Stat3, but it is independent of Stat3-mediated transcription.

Although the presence of Stat3 in mitochondria and its role as regulator of ETC activity has now been widely reported in different cell types, no previous studies have addressed the role of Stat3 in mitochondrial Ca2+. To further determine whether IL-6 increases mitochondrial Ca2+ through Stat3, we examined mitochondrial Ca2+ in Stat3+/+ and Stat3−/− CD4 cells activated in the presence or absence of IL-6. Interestingly, in the absence of Stat3, IL-6 failed to maintain elevated levels of mitochondrial Ca2+ (Figure 5G,H). To show that this effect was not dependent on Stat3 transcriptional activity we also examined mitochondrial Ca2+ in CD4 cells from mut-Stat3 mice. Unlike Stat3 deficient CD4 cells, IL-6 was capable to increase mitochondrial Ca2+ in mut-Stat3 CD4 cells (Figure 5I,J). To further examine whether Stat3 is necessary for the regulation of cytosolic Ca2+ elicited by IL-6, cytosolic Ca2+ levels were measured in Stat3+/+ or Stat3−/− CD4 cells activated in the presence or absence of IL-6 using the Fura-2 AM assay. Unlike Stat3+/+ CD4 cells, IL-6 failed to increase cytosolic Ca2+ in Stat3−/− CD4 cells (Figure 5—figure supplement 2). Together, these data show for the first time that Stat3 contributes to mitochondrial Ca2+ in response to IL-6 and, consequently, cytosolic Ca2+ homeostasis.

Previous studies have demonstrated the association of Stat3 with Complex I of the ETC through GRIM-19, a component of Complex I (Lufei et al., 2003; Gough et al., 2009; Wegrzyn et al., 2009; Tammineni et al., 2013). No studies have reported whether Stat3 is present in the ETC SCs. Our studies above (Figure 2D) indicate that IL-6 facilitates the formation of ETC SCs in CD4 cells. We therefore examined whether mitochondrial Stat3 could also be recruited to the SCs. BN-PAGE was performed using mitochondrial extracts generated with digitonin from CD4 cells activated in the presence or absence of IL-6. SC region of BN-PAGE was excised and resolved by Western blot analysis for Stat3. As described above, the levels of SCs were increased in CD4 cells activated in the presence of IL-6 as determined by the levels of NDUFA9 and NDUFV1 subunits of Complex I (Figure 5K). Interestingly, Stat3 was also present in the SC region isolated from IL-6-treated CD4 cells (Figure 5K). Thus, Stat3 is recruited to the ETC SCs, where it can regulate activity of Complex I through interaction with GRIM-19.

Mitochondrial Ca2+ is essential for IL-6 to sustain the production of IL-21 and IL-4 late during activation of CD4 cells

IL-6, in the absence of other cytokines, is the major inducer of IL-21 production by CD4 cells in mouse and human (Nurieva et al., 2008; Suto et al., 2008; Dienz et al., 2009; Diehl et al., 2012). Stat3 is considered the main transcription factor that induces Il21 gene expression (Chen et al., 2006; Nurieva et al., 2007; Zhou et al., 2007; Kaplan et al., 2011). However, since Stat3 but not its transcriptional activity is required for IL-6 to sustain MMP and Ca2+ during the activation of CD4 cells, this could be an additional mechanism by which IL-6 promotes the production of IL-21. We therefore examined the ability of IL-6 to induce IL-21 production in CD4 cells from mut-Stat3 mice where Stat3 is present but its transcriptional activity is impaired. Similarly to human CD4 cells from patients with Hyper IgE syndrome expressing mut-Stat3, CD4 cells from mut-Stat3 mice have been shown to fail to produce IL-17, another cytokine gene regulated by Stat3 (Ma et al., 2008; Milner et al., 2008; Renner et al., 2008; de Beaucoudrey et al., 2008; Minegishi et al., 2009; Durant et al., 2010; Steward-Tharp et al., 2014). Although IL-6 totally failed to induce IL-21 production in Stat3−/− CD4 cells (Figure 6A), it was able to trigger the production of IL-21 in mut-Stat3 CD4 cells (Figure 6B). Thus, correlating with its role on MMP and mitochondrial Ca2+, Stat3 can contribute to the production of IL-21 in response to IL-6 independently of its function of transcription factor.

A recent study has reported that sustained elevated cytosolic Ca2+ levels are associated with the increased expression of Il21 in CD4 cells in vivo (Shulman et al., 2014). We therefore investigated whether the sustained high MMP elicited by IL-6 late during the activation of CD4 cells could contribute to the production of IL-21 triggered by this cytokine. CD4 cells were activated in the presence or absence of IL-6 for 42 hr and treated with rotenone and antimycin (R/A) or CCCP (to depolarize mitochondria) for another 6 hr. IL-21 levels in the supernatants were determined by Enzyme linked immunosorbent assay (ELISA). Although there were already substantial levels of IL-21 at 42 hr in cells activated with IL-6, these levels steeply rose in the next 6 hr (Figure 6C). However, the increase in IL-21 levels was prevented by the treatment with R/A or CCCP (Figure 6C), indicating that the late production of IL-21 was dependent on the increased MMP caused by IL-6. To further address whether IL-6-mediated mitochondrial Ca2+ contributes to the late production of IL-21, CD4 cells were activated in the presence or absence of IL-6 for 42 hr, and treated with CGP-37157 to inhibit mitochondrial Ca2+ export for another 6 hr. The increase in IL-21 production was also prevented by CGP-37157 (Figure 6C), showing that the increased mitochondrial Ca2+ elicited by IL-6 also contributes to the late production of IL-21. Similarly, CGP-37157 prevented the increase in IL-21 production late during activation in mut-Stat3 CD4 cells, without effecting IL-2 production (Figure 6—figure supplement 1A and B).

We and others have shown that IL-6 can also promote the production of IL-4 during activation airserver 7.2.0 crack et al., 1997; Diehl et al., 2002; Heijink et al., 2002). Like IL-21, sustained elevated cytosolic Ca2+ levels have been associated with the increased expression of Il4 in CD4 cells in vivo (Shulman et al., 2014). We therefore examined the effect that interfering with MMP or Ca2+ has on IL-4 production later during activation. Similar to IL-21, the levels of IL-4 were increased in the last 6 hr in IL-6-stimulated CD4 cells, however R/A, CCCP or CGP-37157 prevented this increase (Figure 6D), indicating that the increased MMP and cytosolic Ca2+ regulated by mitochondrial Ca2+ caused by IL-6 also contributes to the late production of IL-4. In contrast, IL-6 had no effect on IL-2 production and treatment with R/A, CCCP or CGP-37157 had no effect (Figure 6E). We also examined the relative contribution of transcription-independent function of Stat3 in the regulation of these other cytokines by IL-6. Similar to IL-21, IL-4 production was strongly reduced in Stat3−/− CD4 cells, but not in mut-Stat3 CD4 cells (Figure 6—figure supplement 2). In contrast, IL-2 production was more affected in mut-Stat3 CD4 cells than in Stat3−/− CD4 cells (Figure 6—figure supplement 2), further supporting a transcription-independent role of Stat3 in the regulation of IL-21 and IL-4 by IL-6.

To address whether mitochondrial Ca2+ could contribute to the IL-6-mediated gene expression of these cytokines, we also examined mRNA levels of Il21, Il4 and Il2. CD4 cells were activated in the presence of or absence of IL-6, and treated with CGP-37157 to inhibit mitochondrial Ca2+ export. The levels of Il21 and Il4 mRNA were significantly increased in cells treated with IL-6 but 6 hr of CGP-37157 treatment was sufficient to reduce these levels (Figure 6F). In contrast, Il2 mRNA levels were not increased by IL-6, and treatment with CGP-37157 did not have an effect. Thus, mitochondrial Ca2+ regulated by IL-6 is required for sustaining cytokine gene expression induced by IL-6 in CD4 cells late during activation.

In addition, we also addressed the relevance of mitochondrial Ca2+ uptake in the regulation of cytokines by IL-6 using the RU360 compound, a specific MCU inhibitor (Matlib et al., 1998). We confirmed that the treatment with RU360 lowered the mitochondrial Ca2+ levels in CD4 cells activated in the presence of IL-6 (Figure 6—figure supplement 3). Importantly, the treatment with RU360 reduced the production of IL-21 in CD4 cells activated with IL-6 (Figure 6G). RU360 however had no effect on IL-2 production (Figure 6G). Thus, both uptake and export of mitochondrial Ca2+ plays a role in the regulation of cytokine production by IL-6 in CD4 cells.

Increased mitochondrial Ca2+ elicited by IL-6 is required to sustain nuclear NFAT accumulation late during activation of CD4 cells

Il21 gene expression is regulated by Stat3, a Ca2+-independent transcription factor, but it is also regulated by the NFAT transcription factor (Kim et al., 2005; Durant et al., 2010). NFAT is also required for Il4 gene expression (Rao, 1994; Diehl et al., 2002; Rengarajan et al., 2002). Nuclear translocation of NFAT is dependent on increased cytosolic Ca2+ and activation of the Ca2+-dependent phosphatase, calcineurin. Mitochondrial Ca2+ has been shown to contribute to NFAT activation in sensory neurons (Kim and Usachev, 2009). Since we have shown IL-6 promotes NFATc2 nuclear accumulation (Diehl et al., 2002), we examined whether this could be dependent on mitochondrial Ca2+. CD4 cells were activated in the presence of or absence of IL-6 for 42 hr, and treated with CGP-37157 for another 6 hr to inhibit mitochondrial Ca2+ export. The addition of CGP disrupted the nuclear accumulation of NFATc2 in cells treated with IL-6 (Figure 7A). Thus, mitochondrial Ca2+ regulated by IL-6 is required for IL-6 to sustain NFATc2 in the nucleus late during activation.

To address whether NFAT contributes to the production of IL-21 and IL-4 induced by IL-6 late during activation, CD4 cells were activated in the presence or absence of IL-6 for 42 hr, and treated for another 6 hr with FK506, a NFAT inhibitor (FK). FK506 blocked the production of IL-21 and IL-4 induced by IL-6, as determined by ELISA (Figure 7B). In addition, inhibition of NFAT late during activation also reduced Il21 and Il4 mRNA levels in cells exposed to IL-6 (Figure 7C). Therefore, high mitochondrial Ca2+ and nuclear accumulation of NFAT triggered by IL-6 late during activation in CD4 cells is required to sustain expression of Il21 and Il4.

Discussion

Most of the functions of IL-6 in CD4 cells have been assigned to a regulatory role on gene expression through Stat3 as a transcription factor. However, in the light of studies indicating that Stat3 localizes in mitochondria where it regulates the mitochondrial respiratory chain through association with Complex I (Gough et al., 2009; Wegrzyn et al., 2009), it was also possible that IL-6 could have an effect on mitochondria in CD4 cells. Our studies here show for the first time that IL-6 maintains mitochondrial hyperpolarization late during activation of CD4 cells and this has an impact in mitochondrial Ca2+ and, thereby cytosolic Ca2+. We also show that the effect of IL-6 on mitochondrial Ca2+ and baseline cytosolic Ca2+ requires the presence of Stat3, but it is independent of its role as transcription factor.

In recent years, growing interest has been focused on mitochondrial biology in T cells. Bioenergetic profiling of T cells has revealed that T cell metabolism changes dynamically during activation (Wang and Green, 2012; Pearce et al., 2013). Naive T cells maintain low rates of glycolysis and predominantly oxidize glucose-derived pyruvate via OXPHOS, or engage fatty acid oxidation (FAO). After activation, they rapidly switch to anabolic growth and biomass accumulation. This adaption to aerobic glycolysis is specifically required for effector functions in T cells (Chang et al., 2013). IL-2 and IL-15 have been reported to regulate mitochondrial respiration and the balance between glycolysis and oxidative phosphorylation (van der Windt et al., 2012). IL-2 has been shown to support aerobic glycolysis, while IL-15 increases spared respiratory capacity and oxidative metabolism by enhancing mitochondrial biogenesis and FAO in CD8 cells (Pearce et al., 2009; van der Windt et al., 2012). IL-6 has been recently shown to regulate glucose homeostasis in myeloid cells and induce the switch from white adipose tissue to brown fat in cancer induced cachexia (Mauer et al., 2014; Petruzzelli et al., 2014). Here we show that IL-6 enhances the MMP in CD4 cells. However, this is uncoupled from oxidative phosphorylation (i.e. ATP synthesis). In addition, IL-6 does not alter the balance between glycolysis and oxidative glycolysis during activation. Instead, we show that a sustained MMP elicited by IL-6 leads to an effect on mitochondrial Ca2+. No other studies have linked cytokine effects to mitochondrial Ca2+ in CD4 cells.

While endoplasmic reticulum (ER)-derived Ca2+ has been extensively studied in T cells, less is known about mitochondrial Ca2+ homeostasis in T cells. Mitochondrial Ca2+ has been previously shown to modulate store-operated calcium signaling early upon T cell activation at the immunological synapse (Hoth et al., 1997; Quintana et al., 2007). Here we show that IL-6 uses MMP to sustain elevated levels of mitochondrial Ca2+ late during activation and, consequently, elevated levels of cytosolic Ca2+. We have previously shown that the expression of IP3Rs is downregulated during the activation of CD4 cells (Nagaleekar et al., 2008). It is therefore possible that the source of Ca2+ in CD4 cells is reprogramed during activation. ER- IP3R is the main source of Ca2+ during early activation of naive CD4 cells at the synapse. However, mitochondrial Ca2+ could be the major source to sustain cytosolic Ca2+ in activated CD4 cells. Our data indicate that IL-6 sustains cytosolic Ca2+ late during activation by increasing the MMP and mitochondrial Ca2+. This provides a potential mechanism by which Tfh cells have increased free cytosolic calcium levels (Shulman et al., 2014). More importantly, we show here for the first time that mitochondrial Ca2+ plays a key role in promoting increased production of cytokine by effector CD4 cells. Although IP3R-mediated Ca2+ release is essential for the initial induction of cytokine gene expression (Feske, 2007), we have previously shown that IP3R-mediated Ca2+ is not responsible for late production of cytokines by activated CD4 cells (Nagaleekar et al., 2008). Thus, the source of Ca2+ for cytokine production is also reprogrammed during activation of CD4 cells. Although we cannot discard the effect of other transcription factors, our study shows that mitochondrial Ca2+ is required for IL-6 to keep NFATc2 in the nucleus, and that NFAT contributes to late expression of Il21 and Il4.

Mitochondrial respiration has been shown to lead to ROS production caused by proton leaks and ROS can lead to oxidative injury. A number of recent studies have shown that mROS can function as signaling intermediates, and the mROS signaling is required for antigen-specific T cell activation and subsequent IL-2 production (Byun et al., 2008; Schieke et al., 2008; Sena et al., 2013). Although IL-6 increases the MMP, we did not observe an increase in the levels of mROS correlating with the effect of IL-6 facilitating the formation of respiratory SCs. Trojan remover free download full version with key - Activators Patch presence of ETC SCs is emerging as a novel but highly relevant aspect of the mitochondrial function (Acín-Pérez et al., 2008; Althoff et al., 2011). The function of these SCs is to facilitate the transfer of electrons between ETC complexes to minimize the risk of electron leak and, thereby, the risk of producing harmful ROS. Our study demonstrates for the first time the presence of ETC SCs in CD4 cells, and the effect that IL-6 has in promoting the formation of these SCs during activation of CD4 cells. This could be a mechanism by which IL-6 can sustain elevated MMP and Ca2+ while minimizing the production of mROS. Although the association of Stat3 with individual complexes of the ETC has been previous described in heart and cancer cells (Gough et al., 2009; Wegrzyn et al., 2009), here we show for the first time the presence of Stat3 in the ETC SCs in CD4 cells. Stat3 may also be present in mitochondrial SCs in other tissues such as heart.

Thus, here we identify a novel mechanism by which IL-6 promotes the production of IL-21 and IL-4 late during the activation of CD4 cells. This new mechanism involves Stat3 but as a factor regulating MMP and Ca2+ instead of its function as mediator of transcription. Our studies also reveal a novel function of mitochondrial respiration in the control of cytokine production through its effect on mitochondrial Ca2+ homeostasis.

Materials and Methods

Mice

C57BL/6J mice were purchased from Jackson Laboratories. Null IL-6 deficient mice (IL-6 KO) were previously described (Poli et al., 1994). Stat3 conditional knockout (Stat3−/−) mice were generated by crossing the homozygous floxed Stat3 mice (Stat3loxp/loxp) (Takeda et al., 1998) with T cell-specific Lck-Cre transgenic [B6.Cg-Tg(Lck-cre)1Cwi N9] mice (Lee et al., 2001). Mutant-Stat3 (mut-Stat3) mice have been previously described (Steward-Tharp et al., 2014). OT-II TCR transgenic mice have been previously described (Barnden et al., 1998). All mice were housed under sterile conditions at the animal care facility at the University of Vermont. All procedures performed on the mice were approved by the University of Vermont Institutional Animal Care and Use Committee.

Cell purification and activation in vitro

Request a detailed protocol

CD4 cells were isolated from spleen and lymph nodes by negative selection as previously described (Diehl et al., 2002). For Stat3+/+ and Stat3−/− mice, CD4 cells were purified by cell sorting (FACS-Aria; Becton Dickinson). CD4 cells were activated with plate-bound anti-CD3 (2C11) (5 μg/ml) and soluble anti-CD28 (1 μg/ml) (BD Pharmingen, San Diego, CA) mAbs in the presence or absence of IL-6 (50 ng/mL) (Miltenyi Biotec, Auburn, CA). Pharmacological inhibitors were added to culture 42 hr after activation and supernatants were harvested 6 hr later. APCs were purified by depleting CD4 and CD8 T cells using positive selection (Miltenyi), and followed by irradiation treatment (2000 rad). APCs and OT-II CD4 cells were co-cultured at 4:1 ratio in the presence of 5 μM OVA323-339 peptide (Barnden et al., 1998) with or without IL-6 (50 ng /mL) (Miltenyi) or anti-IL-6 (2.5 μg /mL) (BD Pharmingen).

Pharmacological inhibitors used were CGP-37157 (Tocris Bioscience, Ellisville, MO) (10 μM), CCCP (2 μM), rotenone (2 μM), antimycin (2 μM), Ru360 (10 μM), FK506 (InvivoGen, San Diego, CA) (10 nM), Stattic (10 μM).

Immunization experiment in vivo

Request a detailed protocol

OT-II CD4 cells were purified from OT-II TCR transgenic mice (Thy1.1+) by positive selection using anti-CD4 MACS beads (Miltenyi Biotec). 2 × 106 naive OT-II TCR Tg T cells in 100 μL Phosphate buffered saline (PBS) were transferred i.v. into WT or IL-6 KO hosts (Thy1.2+). After overnight, adoptive hosts were simultaneously immunized i.p. with 200 μL of 50 μg OVA absorbed on alum (4.5%, w/v). After 2 d immunization, spleens from immunized mice were harvested and stained with fluorescent conjugated Abs (anti-Thy1.1, anti-Vα2, anti-CD69, anti-CD4, anti-CD44) and TMRE followed by flow cytometry analysis. For each experiment, three to four hosts were used in each group.

Flow cytometry analysis

Request a detailed protocol

MMP analysis was performed by staining CD4 cells with TMRE (Molecular Probes, Eugene, OR) as previously described (Hatle et al., 2013). Mitochondrial calcium analysis was performed by staining with Rhod-2 AM (Invitrogen, Carlsbad, CA; 5 or 10 μM) for 1 hr at 37°C, as previously described (Brisac et al., 2010). mROS production was determined by 10 min staining of cells with 5 μM MitoSox Red (Molecular Probes). Live/dead cell viability staining (Molecular Probes) was performed as recommended by the manufacturer. All samples were examined by flow mediamonkey windows media player - Free Activators analysis using an LSRII flow cytometer (BD Biosciences) and Flowjo software.

Western blot analysis

Request a detailed protocol

Whole-cell extracts were prepared in Triton lysis buffer. Mitochondrial, nuclear and cytosolic extracts were purified using the cell fractionation kit-standard (MitoScience) for CD4 cells. Western blot analyses were performed as previously described (Hatle et al., 2013). Anti-Stat3, anti-phospho-Stat3 (Tyr705) (Cell Signaling, Danvers, MA), anti-actin, anti-GAPDH, anti-rabbit IgG, and anti-goat IgG (Santa Cruz Biotechnology, Santa Cruz, CA); anti-mouse IgG (Jackson Immunologicals, West Grove, PA); anti-CoxIV (Cell Signaling); anti-NDUFA9, anti-NDUFS3 (MitoScience, Eugene, OR) Abs were used.

Electron microscopy imaging

Request a detailed protocol

Cells were suspended in fixative for 60 min at 4°C (2% glutaraldehyde, 0.05% CaCl2, 0.1% MgCl2, 22 mM betaine in 0.1 M Pipes buffer). After rinsing in Pipes buffer, the cell pellets were embedded in 2% SeaPrep agarose, crosslinked with above fixative and postfixed with 1% osmium tetroxide for 1 hr at 4°C. The samples were again rinsed in Pipes buffer, followed by dehydration through graded ethanol, cleared in propylene oxide and embedded in Spurr's epoxy resin. Semithin sections (1 μm) were cut with glass knives on a Reichert ultracut microtome, stained with methylene blue-azure II, and evaluated for areas of interest. Ultrathin sections (60–80 nm) were cut with a diamond knife, retrieved onto 200 mesh thin bar nickel grids, contrasted with uranyl acetate (2% in 50% ethanol) and lead citrate, and examined with a JEOL 1400 TEM (JOEL USA Inc, Peabody, MA) operating at 60 kV. Twenty-five digital images were acquired with an AMT XR611 CCD camera by systemic uniform random sampling from each sample. Number of mitochondria and mitochondria with tight or expanded cristae was counted manually.

Confocal microscopy analysis

Request a detailed protocol

Activated CD4 cells (48 hr) were cytospun and immunostained as previously described (Diehl et al., 2002) using a specific anti-NFATc2 Ab (Upstate Biotechnology, Lake Placid, NY), followed by Alexa568-conjugated secondary Ab. Nuclei were stained with TOPRO (Molecular Probes). Images were recorded using a Zeiss LSM 510 Meta confocal laser scanning imaging system (Carl Zeiss Microimaging, Thornwood, NY).

Blue-native PAGE

Request a detailed protocol

Purified mitochondria were solubilized in Native PAGE loading buffer (Invitrogen) containing 2% digitonin (Sigma-Aldrich Co., St Louis, MO). Complexes were resolved by native electrophoresis through gradient 4–16% Native PAGE Novex Bis-Tris gels (Invitrogen) as previously described (Hatle et al., 2013). Proteins were transferred to PVDF membrane for Western blot analysis with anti-NDUFA9 (MitoScience) and anti-Core I (MitoScience). SCs regions were also excised from BN-PAGE, eluted in SDS sample buffer and resolved in SDS-PAGE. Proteins were then transferred to PVDF membrane for Western blot analysis with anti-NDUFA9, anti-NDUFV1 and anti-Stat3 Abs.

Mitochondrial respiration and extracellular acidification

Request a detailed protocol

OCR were measured, as previously described (van der Windt et al., 2012) under basal conditions and in response to oligomycinv (1 μM), FCCP (1 μM), and rotenone + antimycin A (1 μM) with the Seahorse XF-24 Extracellular Flux Analyzer (Seahorse Bioscience, North Billerica, MA) using the XF Cell Mito Stress Test Kit. ECAR were measured as recommended by the manufacturer using the XF Glycolysis Stress Test Kit.

RNA isolation and RT-PCR

Request a detailed protocol

Total RNA was isolated from CD4 cells using the Qiagen micro RNeasy kit, as recommended by manufacture (Qiagen, Valencia, CA). cDNA synthesis was performed as previously described (Hatle et al., 2013). cDNA was used to quantify the relative mRNA levels for mouse Il21, Il4 and Il2 (Assays-on-Demand by Applied Biosystems) by conventional RT-PCR (Applied Biosystems, San Diego, CA) using β2-microglobulin as housekeeping gene. The relative values were determined by the comparative CT analysis method.

ELISA

Request a detailed protocol

Cytokine levels in cell culture supernatants were determined by ELISA as previously described (Diehl et al., 2002; Dienz et al., 2007, 2009).

ATP and Lactic acid measurement

Request a detailed protocol

ATP was measured on 105 cells and/or 100 μl of culture supernatants by using ATP Lite kit (Perkin Elmer, Boston, MA) as recommended by the manufacturer in a TD-20/20 single tube luminometer. Lactate production was examined in CD4 cells (2 × 106) activated for 48 hr, washed and incubated for 2 hr in media. Measurement of lactate in supernatants was done using the Lactate assay Kit II (BioVision, Milpitas, CA).

Cytosolic calcium measurement

Request a detailed protocol

Cytosolic calcium was measured by staining with Fura-2 AM (Molecular Probes) (5 μM) for 30 min, followed by fluorometrically measurement (340/380 exication, 510 emission) in a Synergy H4 plate reader (Bio-Tek, Winooski, VT). F340/380 value was calculated by dividing the fluorescence reading at 340 nm by the fluorescence at 380 nm exication. Cells were also loaded for 45 min at 37°C with 10 μM Indo-1 (Molecular probes) (Grynkiewicz et al., 1985), harvested, washed and transferred to a standard extracellular solution (140 mM NaCl, 4 mM KCl, 1 mM CaCl2, 2 mM MgCl2, 1 mM KH2PO4, 10 mM glucose, 10 mM HEPES [pH 7.4]). The ratio of Ca2+-bound Indo-1 fluorescence (405 nm) to unbound indo-1 fluorescence (480 nm) was then determined by flow cytometry analysis.

Statistical analysis

Request a detailed protocol

Significance of differences between two groups was determined using GraphPad Prism v. 5.0, by standard Student's t-test. Significance of differences among more than 2 groups was determined by one-way or two-way ANOVA. Standard p < 0.05 was used as the cutoff for significance. For flow cytometry analysis, percentages of compared samples under the same gate were analyzed by t-test or ANOVA in Prism.

References

Источник: https://elifesciences.org/articles/06376

FlowJo Crack + License Key Free Download

FlowJo CrackFlowJo Crack acts to deal with the numerous sources to defeat and accelerate phenotypes. Also, this is immunology and fundamentally includes contributing and generating great work for yourself.

A source that estimates the dissection of information the information adjusts and moves towards more cytometer information. Let us now you can compose and deliver great quality to modernize your great information.

You May also like WinX DVD Ripper Platinum Crack

FlowJo Keygen it is an extremely imaginative graphic information that talks about and classifies programming. In addition, it has become extremely versatile in adapting the exam to the interface and measures the influence as an expert programming designer.

In addition can investigate skeptical instruments and can recognize you by relocating the power of maneuver exploration to your task. Therefore this is a smart research unit.

In this sense, you can now generate a huge amount of information, and you can be shocked by breaking down a lot of information. FlowJo License Key allows you to customize each group with your favorite tasks that you use regularly. Additionally, you can drag swatches or bands to the workspace. The Group section allows you to organize the samples in the order in which you want to analyze them. This is everyone’s basic need for analysis.

FlowJo Crack Key Features

  • Faster even if you have a unique fit
  • Generally scales to larger flowjo alternatives - Free Activators for better updates
  • Getting straight to the point is its own essential nature for beginners.
  • The board is impeccable memory
  • A powerful instrument works flawlessly on Windows and MAC as well
  • Does another task for a natural treble pattern
  • Get your new thoughts as you need with your help to increase your level of exploration
  • Counting new instruments for skeptical questions and scenario
  • There are a large number of FCS documents that acknowledge their long-term availability
  • The application is useful only an instinctive situation to drag and drop include
  • Can work with permission to run your MAC
  • Perfect for every type of client
  • So brilliant program for an innovative exam inside or outside the lab
  • The best demo programming for information exam
  • Adjustable and familiar UI
  • Ability to progressively view essential data about a meeting and its entries.
  • Robotic compensation, simpler to read and examine
  • Chinese, German, French, Japanese, and Spanish are fully included.

FlowJo Full Crack Torrent:

The download process for this tool is also straightforward. Even a new user can easily use it. You can also download this tool from our secure link. It is also the best download platform.

This software can Measurement scales are often logarithmic with excessive precision. This method has many programs for testing health problems, especially most cancers.

It uninstall tool 3.5.7 serial key - Activators Patch analyze data on laptop routinely, which makes it easy for researchers to draw three-dimensional diagrams. The software can be used for every study and clinical purpose and features beneficial tools and competencies in each field.

There are many other great features of this tool. The layout of the main window not only allows you to explore the basic functions of FlowJo Crack. Also, the speed of this tool is amazing.

The entire analysis process is also carried out in a very short period of time. It is also the best analytics platform. In the latest version, programs have been developed for the decomposition and visualization of information about flows.

FlowJo this program can be used for both clinical and research purposes. The user of this tool is available worldwide. You can also customize your ideas. It also provides you with drag and drop functionality. There are also billions of users of this tool.

FlowJo Download With Crack:

FlowJo Serial Number is a pioneer in the discoveries, in fact through curiosity, the style of statistical representation. Also, movable type is an important aspect for you where you can check plugins for that.

You can carry out new projects daily. Also, you are collaborating on the effects you need and then it is platform dependent. You don’t need to worry about building lab data. Because has a new trend for smart projects.

You can download Flowjo mac crack from the link provided. If you think the generator is more PayPal then you are a fool. Here I provide it for free. The latest version developed programming to drill down and display broadcast information.

This program can be used for both clinical and research purposes. The user of this tool is available worldwide. You can also customize your ideas. It also provides you with drag and drop functionality.

FlowJo there are also billions of users of this tool. The download process for this tool is also straightforward. Even a new user can easily use it too. You can also download this tool from our secure link.

It is also the best download platform for all users. After downloading, share your ideas with your friends. You can also share it on different social accounts. It is a powerful program for displaying and analyzing flow cytometer data.

Flow cytometer or FCM is a very suitable method for counting and analyzing microscopic particles such as chromosomes and cells. You can do this using a particular device called a flow cytometer.

FlowJo Registration Key is one of the most advanced software for analyzing and displaying flow data. You can display aggregated data as one-dimensional 2D or 3D histograms.FlowJo Crack

System Requirements

  • 2GB RAM.
  • x86 or x64 dual-core processor.
  • Windows Vista.
  • Oracle Java Runtime Environment 6 (bundled with download).
  • USB port (dongle option).
  • Network adapter for an off-line serial number.
  • Network adapter and an Internet connection.

What’s New?

The Workspace Window in Depth:

flowjo crack

  • The strength of FlowJo activation key lies in the analysis of entire experiments comprising many associated samples. In addition to triggering and statistics, it has special analysis platforms for assays that relate to, among others, DNA / cell cycle, kinetics and proliferation. this software sophisticated tools make it possible to create statistics, charts, tables, websites and even movies. it integrates Remote Data Hosting Services (LIMS) and supports cloud delivery for optimal performance scalability in a demanding, high-throughput environment.
  • Exercises and cassettes:
    Tasks group together similar bands and appear as tabs in the work area. Since there are workspace specific operations, there is a workspace task (see above) which groups similar activities that are typically performed in the workspace eg. For example, add statistics, view sample properties, and create or edit groups. General information on the bands can be found here.
  • The bands group together similar actions. In the image above, for example, the general group actions (group creation, door copy, value copy, and grouping example) are all organized in the group strip.
  • Groups:
    The Groups area lists all groups according to the number of samples (size) and the role played by the group (compensation, control, test sample, etc.). You can edit group properties by double-clicking on a group name.
  • Samples and sample analysis:
    Displays the sample list and associated analysis of the currently selected group, eg. Panel 2.2 (above).

How to install FlowJo Crack?

  1. Firstly, install the FlowJo Crack from the given link.
  2. Secondly, run the crack in the Application directory.
  3. Then, run outside, it will ask the user to browse.
  4. Once cracked, the users can use any serial number to register FlowJo VX.
  5. Enjoy.

Conclusion:

The workspace uses various additional metrics to facilitate analysis: indicator badge: FlowJo license number uses a range of colors and symbols to represent various states (compensated or uncompensated samples, valid or invalid) and internal annotations (open or unopened files) of samples and populations to control the workflow and enable a faster identification of resources. You can find an overview of the badges here.

The color of the text is an important attribute of the work area. It is found in the group identification for subsets and statistics. Each group is assigned a unique color, and the populations in a group inherit the characteristics of the group’s text. You can find more information about groups here.

By default, the Statistics and # Cells columns are displayed. Additional columns can be added to the sampling area to display information such as keywords, staining protocols, notes, etc. If the samples have a keyword called “well identifier”, the samples will now be sorted by that keyword. If this keyword is not found, it will be sorted according to the preference named after sample. To learn more about the sample properties, click here.

 

Источник: https://cracks4soft.com/flowjo-crack/

Thioredoxin peroxidase secreted by Echinococcus granulosus (sensu stricto) promotes the alternative activation of macrophages via PI3K/AKT/mTOR pathway

  • Hui Wang1,2,3na1,
  • Chuan-Shan Zhang1,4na1,
  • Bin-Bin Fang1,
  • Zhi-De Li1,
  • Liang Li1,
  • Xiao-Juan Bi1,
  • Wen-Ding Li1,
  • Ning Zhang1,
  • Ren-Yong Lin1,4 &
  • Hao Wen1,4

Parasites & Vectorsvolume 12, Article number: 542 (2019) Cite this article

  • 826 Accesses

  • 8 Citations

  • 1 Altmetric

  • Metrics details

Abstract

Background

Larvae of Echinococcus granulosus (sensu lato) dwell in host organs for a long time but elicit only a mild inflammatory response, which indicates that the resolution of host inflammation is necessary for parasite survival. The recruitment of alternatively activated macrophages (AAMs) has been observed in a variety of helminth infections, and emerging evidence indicates that AAMs are critical for the resolution of inflammation. However, whether AAMs can be induced by E. granulosus (s.l.) infection or thioredoxin peroxidase (TPx), one of the important molecules secreted by the parasite, remains unclear.

Methods

The activation status of peritoneal macrophages (PMs) derived from mice infected with E. granulosus (sensu stricto) was analyzed by evaluating the expression of phenotypic markers. PMs were then treated in vivo and in vitro with recombinant EgTPx (rEgTPx) and its variant (rvEgTPx) in combination with parasite excretory-secretory (ES) products, and the resulting activation of the PMs was evaluated by flow cytometry and real-time PCR. The phosphorylation levels of various molecules in the PI3K/AKT/mTOR pathway after parasite infection and antigen stimulation were also detected.

Results

The expression of AAM-related genes in PMs was preferentially induced after E. granulosus (s.s.) infection, and phenotypic differences in cell morphology were detected between PMs isolated from E. granulosus (s.s.)-infected mice and control mice. The administration of parasite ES products or rEgTPx induced the recruitment of AAMs to the peritoneum and a notable skewing of the ratio of PM subsets, and these effects are consistent with those obtained after E. granulosus (s.s.) infection. ES products or rEgTPx also induced PMs toward an AAM phenotype in vitro. Interestingly, this immunomodulatory property of rEgTPx was dependent on its antioxidant activity. In addition, the PI3K/AKT/mTOR pathway was activated after parasite infection and antigen stimulation, and the activation of this pathway was suppressed by pre-treatment with an AKT/mTOR inhibitor.

Conclusions

This study demonstrates that E. granulosus (s.s.) infection and ES products, including EgTPx, can induce PM recruitment and alternative activation, at least in part, via the PI3K/AKT/mTOR pathway. These results suggest that EgTPx-induced AAMs might play a key role in the resolution of inflammation and thereby favour the establishment of hydatid cysts in the host.

Background

Cystic echinococcosis (CE), which is caused by Echinococcus granulosus (sensu lato) at the larval stage, is regarded as a severe chronic helminthic disease with a worldwide distribution [1]. Larvae of E. granulosus (s.l.) mainly dwell in the liver and lungs of the intermediate host, where they develop into a unilocular, fluid-filled cyst containing the larval worms or protoscoleces (PSCs). The hydatid cyst can reach several centimeters in diameter and is characterized by mild local inflammation [2, 3]. After the hydatid cyst ruptures, the spillage of PSCs into the peritoneal cavity (PerC) generates new cysts that usually cause a secondary CE infection, which is also a life-threatening form of human CE [4]. Recent studies have shown that the intraperitoneal injection of PSCs into mice induces a significant cellular inflammatory response at the early stage that involves macrophage, eosinophil, neutrophil and lymphocyte infiltration [5, 6], whereas at the cyst establishment stage, the parasite induces inflammatory cell infiltration but generally does not elicit a severe inflammatory response [2, 7]. This phenomenon indicates that E. granulosus (s.l.) has the ability to skew the peritoneal immune response away from a proinflammatory response and toward an anti-inflammatory response to avoid clearance. However, the mechanism through which the parasite modulates the host inflammatory response to favor its establishment in the host is unclear.

Macrophages play a bridge role between innate and adaptive immunity and are thus critical mediators of many chronic inflammatory diseases [8]. Peritoneal macrophages (PMs), which are one of the best-studied macrophage populations, play important roles in the control of infections and inflammatory pathologies [9], and two PM subsets in the mouse PerC were recently classified: large peritoneal macrophages (LPMs) and small peritoneal macrophages (SPMs) [10]. Studies of the functional profiles of these PMs have shown that LPMs appear to play a role in the maintenance of PerC physiological conditions as alternatively activated macrophages (AAMs), whereas SPMs present a pro-inflammatory functional profile during inflammatory initiation and control infections as classically activated macrophages (CAMs) [11]. CAMs are characterized by high expression of inducible nitric oxide synthase (iNOS) and TNF-α and exhibit microbicidal properties. In contrast, AAMs, which are characterized by high expression of mannose receptor (also known as CD206), arginase-1 (Arg-1), Ym1, and Fizz1, generally exhibit anti-inflammatory properties and thus have the ability to suppress Th1-driven inflammatory pathology during helminth infections [8, 12, 13]. In addition, AAMs are critically involved in favoring susceptibility during helminth infection because the early removal of these cells leads to Taenia crassiceps cysticercosis clearance in vivo [14]. Many studies have reported that AAMs are highly activated and recruited during infection with a range of different helminths, such as Heligmosomoides polygyrus [15], Trichinella spiralis [16], Fasciola hepatica [17] and Schistosoma mansoni [18, 19]. It has been reported that E. granulosus (s.l.) infection can effectively inhibit inflammation in a murine colitis model by reducing TNF-α production and iNOS induction by CAMs [20]. However, whether and how AAMs are induced after E. granulosus (s.l.) infection remain to be clarified.

It has been demonstrated that parasite excretory-secretory (ES) products or some released parasite surface molecules can directly modulate host immune cells to promote parasite survival [21,22,23]. ES products derived from E. granulosus (s.l.) are well known to regulate T cell responses, dendritic cell maturation and B cell subset differentiation [24,25,26,27,28,29], but their regulation of macrophage activation is not well understood. Recent studies have shown that E. granulosus (s.l.) laminated layer (LL) extracts can induce arginase expression, a hallmark of AAMs, to counteract NO production by CAMs in mouse PMs in vitro [30]. In addition, LL extracts can also increase PSC survival in macrophage-parasite cocultures, which indicates that LL impairs the host protective inflammatory response by inducing AAM activation. Thioredoxin peroxidase (TPx), an antioxidant enzyme, is expressed during all developmental stages of E. granulosus (s.l.) [31]. A recent proteomic analysis identified EgTPx as one of the abundant ES proteins secreted by the parasite, and this finding suggests that this protein plays an important role in the host-parasite interactions [32,33,34,35]. In addition, we have shown that the knockdown of EgTPx gene expression by RNAi leads to impaired growth of E. granulosus (sensu stricto) both in vitro and in vivo, which indicates that the EgTPx gene plays an important role in parasite survival [36]. Previous studies have shown that the 2-Cys peroxiredoxin (Prx) derived from the flukes S. mansoni and F. hepatica can drive the activation of AAMs [13]. However, whether EgTPx is an atypical 2-Cys Prx that can induce AAMs to shape the immune response of the host to favor hydatid cyst establishment remains unclear.

In this study, we investigated the activation status of PMs in a mouse model infected with E. granulosus (s.s). larvae through intraperitoneal inoculation and evaluated the effect of an important recombinant ES product (rEgTPx) on PM activation in vivo and in vitro. Because the mTOR pathway was recently reported to play a critical role in regulating macrophage differentiation in response to helminth infection [37, 38], we further investigated whether this signaling pathway is involved in EgTPx-induced PM alternative activation.

Methods

Mice

Pathogen-free female BALB/c mice (6 weeks of age) were purchased from Beijing Vital River Laboratory Animal Technology Company Limited, housed in specific pathogen-free facilities with a 12 h light/dark photocycle and provided rodent chow and water ad libitum.

Parasite isolation and ES products preparation

The PSCs of E. granulosus (s.s.) (genotype G1, a common sheep strain) used in this study were obtained from fertile sheep liver hydatid cysts collected from a slaughterhouse in Urumqi, Xinjiang, China, according to the protocols detailed by Zhang et al. [39]. Briefly, the PSCs were removed aseptically from intact cysts, digested with pepsin, washed several times in sterile phosphate-buffered saline (PBS) containing 100 U/ml penicillin and 100 µg/ml streptomycin and then maintained in RPMI 1640 culture medium (Gibco, Auckland, New Zealand) at 37 °C. The viability of the PSCs was determined by methylene blue exclusion analysis [40]. Only the PSC samples with higher than 95% viability were used in the study.

Parasite ES products were prepared following a reliable procedure previously described by other researchers with some modifications [29, 34]. Freshly isolated PSCs were transferred into flasks and cultured at a density of 10,000 PSCs/ml in 20 ml of sterile PBS supplemented with 100 U/ml penicillin and 100 µg/ml streptomycin at 37 °C in 5% CO2. Forty-eight hours after incubation, the entire volume of culture medium containing the parasite ES products (20 ml) was collected, concentrated 40-fold using Amicon Ultra-15 centrifugal filters (Millipore, Billerica, MA, USA), and filtered through a 0.22 µm filter (Millipore, Billerica, Plex media server crack linux - Crack Key For U, USA). The concentration of the ES products was measured using a BCA assay (Thermo Fisher Scientific, Rockford, IL, USA), and the products were stored at − 80 °C until use.

Preparation of a recombinant ES product (rEgTPx) and its variant (rvEgTPx)

Total RNA from E. granulosus (s.s.) PSCs was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommended protocol. The extracted RNA was treated with RNase-free DNase I (Fermentas, Vilnius, Lithuania) to remove potential genomic DNA contaminants and then reverse transcribed into cDNA using the PrimeScriptTM RT Reagent Kit (Fermentas, Vilnius, Lithuania). The complete open reading frame (ORF) of EgTPx was amplified using gene-specific primers containing EcoRI and Not I restriction sites and ligated into the pET-28a vector with an N-terminal 6× His-tag (Novagen, Madison, WI, USA). The expression construct was transformed into competent Escherichia coli BL21 (DE3) cells (Tiangen, Beijing, China.) and purified using a His-binding resin (Novagen) according to the manufacturer’s instructions. A recombinant variant of EgTPx (rvEgTPx) was prepared by synthesizing the gene with the reactive Cys48 and Cys169 residues replaced by Gly residues. Residual bacterial endotoxin was removed from the purified recombinant proteins by phase separation using Triton X-114. The protein purity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and the protein concentrations were measured using a BCA protein assay kit (Thermo Fisher Scientific).

The specific enzymatic activities of rEgTPx and rvEgTPx were determined through metal-catalyzed oxidation (MCO) DNA cleavage protection assays [31]. Briefly, purified rEgTPx and rvEgTPx proteins with final concentrations ranging from 6.25 to 100 μg/ml were incubated in 50 μl reaction mixtures containing 16.5 μM FeCl3 and 3.3 mM dithiothreitol (DTT) for 2 h at 37 °C and then with pET28a (800 ng) supercoiled plasmid DNA for an additional 2.5 h. The degree of DNA degradation was evaluated by electrophoresis with a 1.0% (w/v) agarose gel. The correct folding of rEgTPx and its variant was confirmed by assessing their migration via SDS-PAGE under reducing and nonreducing conditions [13].

Animal infection and treatment with parasite antigens

For infection, each mouse was intraperitoneally (i.p.) transplanted with 50 E. granulosus (s.s.) microcysts (250–300 μm in diameter) cultured in vitro as previously described [39] or directly inoculated with 200 μl of a suspension containing 2000 live PSCs in PBS [29]. The control mice were injected with 200 μl of PBS. After the experimental period (3 or 6 months post-infection), the mice were necropsied, and peritoneal exudate cells (PECs) were harvested through three washes of the PerC with 5 ml of sterile PBS. For parasite antigen treatment, the mice were administered nine i.p. injections of 5 μg of the parasite ES products or purified rEgTPx or rvEgTPx on alternate days, and PBS was injected as a negative control. PECs were harvested 2 days after the final injection.

In vitro treatment of PMs with parasite antigens

For in vitro experiments, PMs were elicited through the i.p. injection of 800 μl of 4% w/v sterile thioglycollate medium into mice and the harvesting of PECs four days post-injection [12]. For antigen treatment, the purified PMs were adjusted to a density of 1 × 106 cells/ml and then cultured with PBS or 10 μg/ml parasite ES products, rEgTPx or rvEgTPx in a six-well plate for 24 h, and lipopolysaccharide (LPS; 50 ng/ml, Sigma, St. Louis, MO, USA) and IL-4 (20 ng/ml, PeproTech, Rocky Hill, CT, USA) were used as the negative and positive controls, respectively [19]. The cells were washed with PBS and then analyzed by quantitative real-time PCR (qRT-PCR).

To determine whether the PI3K/AKT/mTOR pathway is involved in the alternative activation of PMs, the PMs were preincubated with the inhibitors LY294002 (an Akt-specific inhibitor, Selleck Chemicals, Houston, TX, USA) and rapamycin (a mTOR inhibitor, Selleck Chemicals) for 1 h and then cultured with parasite antigens (50 μg/ml ES products and 10 μg/ml rEgTPx) for 12 h. After the treatments, cell lysates were collected for assessment of the Akt and mTOR phosphorylation levels by Western blotting.

Flow cytometry analysis

PMs were purified from PECs as described previously [12], and the PEC purity was analyzed by fluorescence-activated cell sorting (FACS) staining using the macrophage markers F4/80 and CD11b. For cell morphology analysis, adherent macrophages from uninfected and E. granulosus (s.s.)-infected mice were imaged using an inverted microscope (Leica, Wetzlar, Germany). For FACS analysis, the PECs were adjusted to a density of 1 × 106 cells/ml, incubated with anti-CD16/CD32 antibodies (BioLegend, San Diego, CA, USA) for 20 min at 4 °C in the dark and then stained with the following fluorescently labeled antibodies specific for cell surface markers for 25 min: anti-CD45; anti-NK1.1; anti-CD3; anti-CD19; anti-F4/80; anti-CD11b, anti-CD80; anti-CD86; and anti-MHC II (BioLegend). For detection of the CAM and AAM phenotypes, the PECs were stained with anti-CD45, anti-NK1.1, anti-CD3, anti-CD19, anti-F4/80, and anti-CD11b antibodies at 4 °C for 30 min, washed and then fixed in Cytofix/Cytoperm (BD Biosciences, Franklin Lakes, NJ, USA) according to the manufacturer’s instructions for staining with anti-CD206 (AAM marker) and anti-iNOS (CAM marker) antibodies. All samples were run on an LSRFortessa flow cytometer (BD Immunocytometry Systems, San Jose, CA, USA), and the data were analyzed using FlowJo software (version V10; TreeStar Inc., Ashland, OR, USA). Corresponding fluorochrome-labeled IgG isotype control antibodies were used in parallel. The percentage of cells that were stained positive for each surface protein was determined by comparing the test samples with the isotype control-stained samples. Information on the antibodies utilized in this assay is shown in Additional file 1: Table S1.

Western blot analysis

The cells were lysed in RIPA buffer containing a phosphatase and protease inhibitor cocktail (EMD Millipore, Temecula, CA, USA). Thirty micrograms of protein was separated by 10% SDS-PAGE, transferred to polyvinylidene fluoride (PVDF) membranes (Millipore Corp., MA, USA), and incubated with rabbit anti-phospho-mTOR (1:1000), anti-mTOR (1:1000), anti-phospho-AKT (1:1000), anti-AKT (1:1000), anti-PI3K (1:1000), or anti-β-actin (1:1000) antibodies overnight at 4 °C. The membranes were then incubated with alkaline phosphatase-conjugated anti-rabbit IgG antibodies (1:2000; Cell Signaling Technology, Danvers, MA, USA) for 1 h and visualized using a BCIP/NBT kit (Invitrogen, Carlsbad, CA, USA).

qRT-PCR analysis

Total RNA from PMs was isolated and reverse transcribed into cDNA as described above. qRT-PCR was conducted using the SYBR Green PCR premix (TaKaRa, Dalian, China) and run on a qRT-PCR instrument (iQ5 Bio-Rad, Hercules, CA, USA) as described previously [41]. The reaction conditions were as follows: stage 1, 95 °C for 30 s; stage 2, 40 cycles of 95 °C for 5 s and 60 °C for 30 s; and stage 3, melting curve analysis. The relative expression of the target genes was determined by the comparative quantification cycle (Cq) normalized against the housekeeping gene (GAPDH) using the 2−ΔΔCq method [29, 42]. The sequences of all primers used in this analysis are shown in Table 1.

Full size table

Statistical analysis

The results are presented as the mean ± standard error of the mean (SEM) and were analyzed using GraphPad Prism software (GraphPad Software, Inc., USA). The statistical significance was assessed by one-way ANOVA with Tukey’s multiple comparison test, and Student’s t-test was used for the comparisons of only two groups. Differences were considered significant at *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Results

Echinococcus granulosus (s.s.) infection induces PMs to differentiate into an alternatively activated phenotype

To determine whether E. granulosus (s.s.) infection induces the alternative activation of PMs, PMs were collected by adherence from mice 6 months after infection with E. granulosus (s.s.) microcysts. The expression of the genes encoding Ym1, Fizz1 and Arg1 (AAM marker) and iNOS (CAM marker) in PMs was examined. We found that E. granulosus (s.s.) infection increased the recruitment of PECs to the PerC (t(8) = 2.65, P = 0.03) (Fig. 1a). PMs isolated from the PerC of infected mice (Eg-Mφ) showed higher expression levels of Ym1, Fizz1 and Arg1 than PMs isolated from control mice treated with PBS (PBS-Mφ). Very low levels of iNOS expression were detected (Fig. 1b). In addition, the morphology of the Eg-Mφ differed from that of the PBS-Mφ. The Eg-Mφ were tightly adherent with spread-out processes, whereas the PBS-Mφ were less adherent and showed a more rounded shape, which might indicate a distinct functional role for Eg-Mφ (Fig. 1c).

E. granulosus (s.s.) infection induces an alternatively activated phenotype in macrophages and different cell morphologies. a Total counts of peritoneal exudate cells (PECs) isolated from E. granulosus-infected or control mice. b Expression levels of phenotypic markers (Ym1, Arg1, Fizz1 and iNOS) in adherent PECs isolated from control mice and infected mice analyzed by RT-PCR. c Morphological observation of adherent PECs isolated from control mice and infected mice. The data are shown as the mean ± SEM (n = 5). Abbreviations: Con, control; E. g., E. granulosus (s.s.). *P < 0.05. Scale-bars: c, 200 µm for 100×; 100 µm for 200×

Full size image

rEgTPx induces PMs to differentiate into an alternatively activated phenotype in vivo

To evaluate the effects of the important ES product EgTPx on the activation of PMs and to determine whether the antioxidant activity of EgTPx is involved in PM activation, we first constructed rEgTPx and then created an inactive recombinant variant (rvEgTPx) by replacing Cys48 and Cys169 with Gly residues (Additional file 2: Figure S1a). At a relatively high concentration, rEgTPx prevented the processing of plasmid DNA from a supercoiled form to a nicked form in an MCO system. However, rvEgTPx did not protect against this type of damage (Additional file 2: Figure S1b). In addition, rvEgTPx did not form disulfide linkages and thus mainly remained in its monomeric form under nonreducing conditions (Additional file 2: Figure S1c), which further confirmed that the variant was constructed successfully.

Mice were then administered nine intraperitoneal injections of rEgTPx, rvEgTPx or native parasite ES products and were also intraperitoneally injected with PSCs for 3 months in parallel with the antigen treatments. PECs were harvested and examined by RT-PCR and FACS. Similar to the results obtained with E. granulosus (s.s.) infection, PMs isolated from ES- and rEgTPx-treated mice also showed higher expression levels of AAM-related genes (Ym1, Fizz1 and Arg1) than these cells from the control mice (Additional file 2: Figure S1d). We identified the CD11bhighF4/80high LPM and CD11blowF4/80low SPM populations in the PECs after excluding cell aggregates and other peritoneal immune cells using an antibody cocktail that recognizes CD3, NK1.1 and CD19 (Additional file 3: Figure S2). The percentages of LPMs and SPMs were significantly decreased (F(3, 16) = 100.4, P < 0.0001) and increased (F(3, 16) = 164.5, P < 0.0001) in the ES and rEgTPx treatment groups and the E. granulosus (s.s.) infection group compared with the rvEgTPx and PBS control groups (Figs. 2a, b, 3a, b). We subsequently examined the expression of CAM (iNOS) and AAM (CD206) markers in these PM subsets, and sam broadcaster pro 2018.5 crack - Activators Patch results showed that compared with the administration of PBS, the delivery of ES products and rEgTPx or infection with PSCs significantly increased the percentage of CD206+ macrophages in both the LPM (F(3 16) = 41.22, P < 0.0001) and SPM (F(3, 16) = 251.7, P < 0.0001) subsets and reduced the percentage of iNOS+ macrophages in the SPM subset (F(3, 16) = 8.9, P = 0.0008) (Figs. 2c, 3c and Additional file 4: Figure S3). Interestingly, lack of EgTPx enzymatic activity (rvEgTPx delivery) had no effect on the ability to skew PMs toward the AAM phenotype. In addition, we found that the mean fluorescence intensity (MFI) of CD80 in the LPMs from ES- and rEgTPx-injected and PSC-infected mice was significantly increased (F(3, 16) = 10.99, P = 0.0004), but no differences in the MFIs of CD86 and MHC II were detected. In contrast, the MFIs of MHC II were significantly increased (F(3, 16) = 3.19, P = 0.0486) in the SPMs from rEgTPx-injected and PSC-infected mice. The MFI of FSC-A in both the LPMs (F(3, 16) = 16.03, P < 0.0001) and SPMs (F(3, 16) = 11.72, P = 0.0003) from ES- and rEgTPx-injected and PSC-infected mice was higher than that in the same cell populations from control mice (Figs. 2c, 3c).

Parasite antigen treatment skewed the PM subsets and induced an alternatively activated phenotype in PMs in vivo. a Representative FACS plots of LPMs and SPMs. b Percentages of CD11bhighF4/80high LPMs and CD11bintF4/80int SPMs in the peritoneal exudates from mice belonging to the different groups. c Percentages of iNOS+ macrophages (CAMs) and CD206+ macrophages (AAMs) in LPMs and SPMs and the expression patterns of cell surface markers (CD80, CD86, and MHCII) in LPMs and SPMs after parasite antigen treatment. The sizes of LPMs and SPMs were determined using the FSC-A parameter. The data are depicted as the mean fluorescence intensities (MFIs) for each surface marker. The data are shown as the mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001

Full size image

E. granulosus (s.s.) infection skewed the PM subsets and induced an alternatively activated phenotype in PMs. a Representative FACS plots of LPMs and SPMs. b Percentages of CD11bhighF4/80high LPMs and CD11bintF4/80int SPMs in the peritoneal exudates from photofiltre download - Crack Key For U mice and control mice. c Percentages of iNOS+ macrophages (CAMs) and CD206+ macrophages (AAMs) in LPMs and SPMs and the expression patterns of cell surface markers (CD80, CD86, and MHCII) in LPMs and SPMs after E. granulosus (s.s.) infection. The sizes of LPMs and SPMs were determined using the FSC-A parameter. The data are depicted as the mean fluorescence intensities (MFIs) for each surface marker and are shown as the mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001. Abbreviation: E. g., E. granulosus (s.s.)

Full avs video editor crack download for pc image

rEgTPx induces PMs to differentiate into an alternatively activated phenotype in vitro

To evaluate the effects of rEgTPx on macrophage phenotypes in vitro, thioglycollate-elicited PMs were purified and treated with ES products, rEgTPx, rvEgTPx, LPS (negative control) or IL-4 (positive control), and the expression of CAM and AAM markers in these PMs were then determined by qRT-PCR. The results showed that compared with the PBS control treatment, the ES product and rEgTPx treatments significantly upregulated the expression of Ym1 (F(5, 12) = 38.92, P < 0.0001), Fizz1 (F(5, 12) = 22.74, P < 0.0001), Arg1 (F(5, 12) = 9.50, P = 0.0001) and the level of the anti-inflammatory cytokine IL-10 (F(5, 12) = 15.56, P < 0.0001). However, the expression of iNOS and TNF-α was detectable but relatively weak. In addition, treatment with rvEgTPx also increased the expression of Ym1, Fizz1, and Arg1, but the detected levels were lower relative to those observed after treatment with the ES product or rEgTPx (Fig. 4). These results suggest that ES and rEgTPx can preferentially induce an anti-inflammatory AAM phenotype in vitro.

Parasite antigen treatment induced an alternatively activated phenotype in PMs in vitro. PMs from normal mice were purified and stimulated with different parasite antigens for 24 h. LPS and IL-4 were included as positive controls for CAMs and AAMs, respectively. The transcript levels of AAM markers (YM1, Arg1, Fizz1 and IL-10) and CAM markers (iNOS and TNF-α) were evaluated by real-time PCR. The expression levels of each molecule were determined by the comparative Cq value normalized against the GAPDH using the 2−ΔΔCq method. The data are presented as the mean ± SEM from three independent experiments. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001

Full size image

rEgTPx induces AAMs by activating the PI3K/AKT/mTOR signaling pathway

To determine whether the PI3K/AKT/mTOR signaling pathway is involved in the parasite antigen-induced alternative activation of macrophages, the phosphorylation status of mTOR pathway components in PMs isolated from the parasite-infected and antigen-injected mice described above was assessed through a Western blot analysis. The ES product and rEgTPx injections induced higher phosphorylation levels of mTOR (F(5, 24) = 36.02, P < 0.0001) and Akt (F(5, 24) = 36.21, P < 0.0001) in the PMs compared with those obtained after PBS injection, and these results were consistent with those observed after E. granulosus (s.s.) infection. Similarly, the expression of PI3K and AKT was also upregulated. However, the phosphorylation levels of mTOR and AKT in the PMs derived from the rvEgTPx-injected mice were similar to those in the PMs derived from the PBS control mice, and the expression of PI3K was also similar (Fig. 5a, b, Additional file 5: Figure S4).

Parasite antigen (rEgTPx) induces an alternatively activated phenotype in macrophages via the PI3K/AKT/mTOR pathway. a, b Western blot analysis and quantification of phosphorylated and total mTOR and AKT protein levels in whole-cell lysates of adherent PECs isolated from control mice and parasite-infected and antigen-treated mice. c, d Effects of inhibitors on P-AKT and P-mTOR expression in macrophages. The data are shown as the mean ± SEM (n = 5). *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. Abbreviations: Con, control; E. g., E. granulosus (s.s.)

Full size image

We used various inhibitors in this study to further identify the importance of this pathway in the parasite antigen-induced alternative activation of macrophages. We found that LY294002 (an AKT-specific inhibitor) and rapamycin (an mTOR inhibitor) significantly attenuated the phosphorylation of AKT (F(6, 14) = 456.4, P < 0.0001) and mTOR (F(6, 14) = 1428, P < 0.0001) compared with the levels found in the ES product- or rEgTPx-stimulated PMs (Fig. 5c, d, Additional file 5: Figure S4). These results indicate that the parasite antigen-induced alternative activation of PMs is likely mediated by the PI3K/AKT/mTOR signaling pathway.

Discussion

An accumulating body of evidence shows that the alternative activation of macrophages is a hallmark of helminth infections and plays an important immunomodulatory role in these infections by not only limiting inflammation but also preventing excessive tissue remodeling [15, 18, 43, 44]. This limited inflammation has been confirmed as one of the main survival strategies of helminths that allows them to reside in their intermediate hosts for a long time [45]. However, the activation status of macrophages during infection with E. granulosus (s.s.), which is a major species of the genus Echinococcus belonging to the family Taeniidae of the cestode platyhelminths [46, 47] that causes CE, remains poorly defined. In this study, we showed that intraperitoneal infection with E. granulosus (s.s.) larvae and the injection of ES products secreted by the parasite, including EgTPx, induced the recruitment of large numbers of PMs to the PerC and the preferentially differentiation of PMs toward an AAM phenotype. Furthermore, we found that EgTPx induces the alternative activation of PMs via the PI3K/AKT/mTOR pathway and that this activation is dependent on the antioxidant activity of EgTPx, which suggests that EgTPx plays multiple roles in favoring the survival of hydatid cysts in the host.

The mouse model of intraperitoneal infection with E. granulosus (s.l.) is the most widely used model that mirrors the secondary infection that occurs in the intermediate host after fertile cyst rupture [4, 48], and PMs, which are one of the most-studied macrophage populations [9, 10], have been used in many recent studies investigating the responses of macrophages related to parasitic diseases such as schistosomiasis [18, 19]. Therefore, we characterized the phenotypes of PMs isolated from the PerC of infected mice. Similar to the findings obtained with other helminth infections [13, 17, 18], our results showed that E. granulosus (s.s.) infection recruited a relatively large number of PECs to the PerC and that most of the recruited cells were preferentially differentiated into the AAM phenotype during the late stage of E. granulosus (s.s.) infection. Previous studies using this model have shown that macrophages are also prominent in the early infiltrate, but that infiltration does not develop into a severe inflammatory response during the cyst establishment stage. Thus, based on our results, we speculate that the parasite might have adapted to avoid the host inflammatory response through the activation of AAMs.

Recent studies have shown that the LL, the interface between the parasite and the host, is permeable, which allows E. granulosus (s.l.) ES products to pass through and directly interact with the immune cells around the cyst [32, 49]. It is evident that LL extracts, which might contain some uncharacterized ES products, can induce arginase expression in vitro and enhance the induction of Ym1 expression in vivo, which indicates that the LL and the materials shed from the LL could have the capacity to promote AAM activation to favor parasite survival [30, 50, 51]. Our present results showed that EgTPx, one of the abundant ES products that has been confirmed to play an important role in antioxidant defense against the host during development [36], could not only induce the alternative activation of PMs in vivo but also modulate the differentiation of PMs toward an alternatively activated phenotype in vitro. These results are consistent with those found for Prx derived from the flukes S. mansoni and F. hepatica [13].

In addition, infectious and inflammatory stimuli, such as Trypanosoma cruzi infection, usually alter the PM composition in the PerC due to the disappearance of LPMs of embryogenic precursor origin and the notable increase in the numbers of SPMs of bone marrow origin, which results in marked LPM disappearance and SPM expansion in the PerC [9,10,11]. We and other research groups have also shown that LL-derived particles and rEgTPx induce similar changes that skew the PM subsets from LPMs to SPMs [51]. SPMs generally present a proinflammatory functional profile during inflammation initiation and might elicit acute inflammation. However, we found that the percentages of CD206+ SPMs and CD206+ LPMs in mice were significantly increased after the administration of nine injections of rEgTPx or ES products. These results indicate that rEgTPx and ES products derived from E. granulosus (s.s.) can not only recruit a wave of blood monocytes into the PerC that differentiate into SPMs but also skew the differentiation of SPMs toward an anti-inflammatory phenotype over time, which would favor the establishment of parasites in the host and, to some extent, mimic natural infection.

Our analysis of surface markers showed that SPMs, particularly those from rEgTPx-injected mice, expressed high levels of MHC-II, whereas LPMs did not express this classical activation marker but did exhibit higher expression levels of CD80 than those found in SPMs. These observations are consistent with the reported characteristics of these two types of cells [10]. Furthermore, macrophages reportedly have the ability to promote immune tolerance by directly inducing Tregs [52], and we detected a predominant upregulation of the mRNA level of IL-10, a crucial Treg-inducing cytokine [53], in PMs exposed to rEgTPx in vitro, which might indicate that these PMs support Treg generation. To further clarify whether this immunoregulatory function of EgTPx can be attributed to its antioxidant activity, we also constructed an inactive variant of EgTPx and revealed that the EgTPx-mediated alternative activation of macrophages depends on the antioxidant activity of the enzyme.

Various lines of evidence show that mTOR and its related pathways can regulate the functions of dendritic cells [54, 55], monocytes [56] and macrophages [38, 57]. In addition, recent studies have clearly demonstrated that AKT and mTOR signaling play key roles in promoting the alternative activation of macrophages [37, 58]. Here, we found that rEgTPx and ES products secreted by E. granulosus (s.s.) trigger AKT and mTOR phosphorylation and upregulate the expression of the upstream regulator PI3K, which indicates that stimulation with these parasite antigens activates the PI3K/AKT/mTOR pathway. However, this activated pathway can be suppressed by pre-treatment with an inhibitor of AKT (LY294002) or mTOR (rapamycin). Therefore, the activation of the PI3K/AKT/mTOR pathway is, at least in part, the most likely mechanistic explanation for the effects of rEgTPx and ES products on the alternative activation of macrophage. Inhibition of the mTOR signaling pathway might become a novel therapeutic approach for altering the survival of parasites.

Conclusions

Our data demonstrate that PMs are recruited and preferentially induced to differentiate toward an alternatively activated phenotype after intraperitoneal infection with E. granulosus (s.s.) larvae. EgTPx, an important antioxidant enzyme secreted by E. granulosus (s.s.), can induce the alternative activation of PMs both in vivo and in vitro, and this induction is dependent on the antioxidant activity of this enzyme, which suggests that EgTPx plays dual roles in the survival of cysts in the host by not only resisting oxidative damage but also regulating macrophage activation to overcome inflammation. Furthermore, we found that the PI3K/AKT/mTOR signaling pathway might play an important role during E. granulosus (s.s.) antigen (EgTPx)-induced alternative activation of macrophages, which implies that inhibition of the mTOR pathway to modulate the macrophage activation status could become a novel therapeutic strategy for controlling parasitic diseases and some inflammatory disorders. Further identification of the immunomodulatory function of the important ES product EgTPx will promote the development of novel preventive strategies against CE.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article and its additional files.

Abbreviations

alternatively activated macrophages

arginase-1

classically activated macrophages

excretory-secretory products

Echinococcus granulosus thioredoxin peroxidase

fluorescence-activated cell sorting

inducible nitric oxide synthase

large peritoneal macrophages

mean fluorescence intensity

nitric oxide

protoscoleces

phosphate-buffered saline

peritoneal exudate cells

peritoneal macrophages

recombinant EgTPx

recombinant variant EgTPx

small peritoneal macrophages

References

  1. 1.

    Wen H, Vuitton L, Tuxun T, Li J, Vuitton DA, Zhang W, et al. Echinococcosis: advances in the 21st century. Clin Microbiol Rev. 2019;32:e00075-18.

    PubMedArticle Google Scholar

  2. 2.

    Zhang W, Li J, McManus DP. Concepts in immunology and diagnosis of hydatid disease. Clin Microbiol Rev. 2003;16:18–36.

    CASPubMedPubMed CentralArticle Google Scholar

  3. 3.

    Vatankhah A, Halasz J, Piurko V, Barbai T, Raso E, Timar J. Characterization of the inflammatory cell infiltrate and expression of costimulatory molecules in chronic Echinococcus granulosus infection of the human liver. BMC Infect Dis. 2015;15:530.

    CASPubMedPubMed CentralArticle Google Scholar

  4. 4.

    Mourglia-Ettlin G, Merlino A, Capurro R, Dematteis S. Susceptibility and resistance to Echinococcus granulosus infection: associations between mouse strains and early peritoneal immune responses. Immunobiology. 2016;221:418–26.

    CASPubMedArticle Google Scholar

  5. 5.

    Fotiadis C, Sergiou C, Kyrou I, Troupis TG, Tselentis J, Doussaitou P, et al. Experimental echinococcus infection in the mouse model: pericystic cellular immunity reaction and effects on the lymphoid organs of immunocompetent and thymectomized mice. Vivo. 1999;13:541–6.

    CAS Google Scholar

  6. 6.

    Magambo JK, Zeyhle, Wachira TM, Wachira J, Raasen T. Cellular immunity to Echinococcus granulosus cysts. Afr J Health Sci. 1995;2:250–3.

    PubMed Google Scholar

  7. 7.

    Zhang W, Ross AG, McManus DP. Mechanisms of immunity in hydatid disease: implications for vaccine development. J Immunol. 2008;181:6679–85.

    CASPubMedArticle Google Scholar

  8. 8.

    Muraille E, Leo O, Moser M. TH1/TH2 paradigm extended: macrophage polarization as an unappreciated pathogen-driven escape mechanism? Front Immunol. 2014;5:603.

    PubMedPubMed Central Google Scholar

  9. 9.

    Cassado Ados A, D’Imperio Lima MR, Bortoluci KR. Revisiting mouse peritoneal macrophages: heterogeneity, development, and function. BeeCut 1.8.2.32 + Crack [ Latest Version ] 2021 (completecrack) Immunol. 2015;6:225.

    PubMed Google Scholar

  10. 10.

    Ghosn EE, Cassado AA, Govoni GR, Fukuhara T, Yang Y, Monack DM, et al. Two physically, functionally, and developmentally distinct peritoneal macrophage subsets. Proc Natl Acad Sci USA. 2010;107:2568–73.

    CASPubMedArticlePubMed Central Google Scholar

  11. 11.

    Cassado Ados A, de Albuquerque JA, Sardinha LR, Buzzo Cde L, Faustino L, Nascimento R, et al. Cellular renewal and improvement of local cell effector activity in peritoneal cavity in response to infectious stimuli. PLoS ONE. 2011;6:e22141.

    PubMedArticleCASPubMed Central Google Scholar

  12. 12.

    Nair MG, Cochrane DW, Allen JE. Macrophages in chronic type 2 inflammation have a novel phenotype characterized by the abundant expression of Ym1 and Fizz1 that can be partly replicated in vitro. Immunol Lett. 2003;85:173–80.

    CASPubMedArticlePubMed Central Google Scholar

  13. 13.

    Donnelly S, Stack CM, O’Neill SM, Sayed AA, Williams DL, Dalton JP. Helminth 2-Cys peroxiredoxin drives Th2 responses through a mechanism involving alternatively activated macrophages. FASEB J. 2008;22:4022–32.

    CASPubMedPubMed CentralArticle Google Scholar

  14. 14.

    Reyes JL, Terrazas CA, Alonso-Trujillo J, van Rooijen N, Satoskar AR, Terrazas L. Early removal of alternatively activated macrophages leads to Taenia crassiceps cysticercosis clearance in vivo. Int J Parasitol. 2010;40:31–42.

    ArticleCAS Google Scholar

  15. 15.

    Anthony RM, Urban JF Jr, Alem F, Hamed HA, Rozo CT, et al. Memory T(H)2 cells induce alternatively activated macrophages to mediate protection against nematode parasites. Nat Med. 2006;12:955–60.

    CASPubMedPubMed CentralArticle Google Scholar

  16. 16.

    Dzik JM, Golos B, Jagielska E, Zielinski Z, Walajtys-Rode E. A non-classical type of alveolar macrophage response to Trichinella spiralis infection. Parasite Immunol. 2004;26:197–205.

    CASPubMedArticlePubMed Central Google Scholar

  17. 17.

    Donnelly S, O’Neill SM, Sekiya M, Mulcahy G, Dalton JP. Thioredoxin peroxidase secreted by Fasciola hepatica induces the alternative activation of macrophages. Infect Immun. 2005;73:166–73.

    CASPubMedPubMed CentralArticle Google Scholar

  18. 18.

    Xu J, Zhang H, Chen L, Zhang D, Ji M, Wu H, Wu G. Schistosoma japonicum infection induces macrophage polarization. J Biomed Res. 2014;28:299–308.

    CAS

Источник: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-019-3786-z

Open Access

Peer-reviewed

  • Reto Guler ,
  • Suraj P. Parihar ,
  • Suzana Savvi,
  • Erin Logan,
  • Anita Schwegmann,
  • Sugata Roy,
  • Natalie E. Nieuwenhuizen,
  • Mumin Ozturk,
  • Sebastian Schmeier,
  • Harukazu Suzuki,
  • Frank Brombacher
  • Reto Guler, 
  • Suraj P. Parihar, 
  • Suzana Savvi, 
  • Erin Logan, 
  • Anita Schwegmann, 
  • Sugata Roy, 
  • Natalie E. Nieuwenhuizen, 
  • Mumin Ozturk, 
  • Sebastian Schmeier, 
  • Harukazu Suzuki
PLOS

x

Figures

Abstract

Classical activation of macrophages (caMph or M1) is crucial for host protection against Mycobacterium tuberculosis (Mtb) infection. Evidence suggests that IL-4/IL-13 alternatively activated macrophages (aaMph or M2) are exploited by Mtb to divert microbicidal functions of caMph. To define the functions of M2 macrophages during tuberculosis (TB), we infected mice deficient for IL-4 receptor α on macrophages (LysMcreIL-4Rα-/lox) with Mtb. We show that absence of IL-4Rα on macrophages does not play a major role during infection with Mtb H37Rv, or the clinical Beijing strain HN878. This was demonstrated by similar mortality, bacterial burden, histopathology and T cell proliferation between infected wild-type (WT) and LysMcreIL-4Rα-/lox mice. Interestingly, we observed no differences in the lung expression of inducible nitric oxide synthase (iNOS) and Arginase 1 (Arg1), well-established markers for M1/M2 macrophages among the Mtb-infected groups. Kinetic expression studies of IL-4/IL-13 activated bone marrow-derived macrophages (BMDM) infected with HN878, followed by gene set enrichment analysis, revealed that the MyD88 and IL-6, IL-10, G-CSF pathways are significantly enriched, but not the IL-4Rα driven pathway. Together, these results suggest that IL-4Rα-macrophages do not play a central role in TB disease progression.

Citation: Guler R, Parihar SP, Savvi S, Logan E, Schwegmann A, Roy S, et al. (2015) IL-4Rα-Dependent Alternative Activation of Macrophages Is Not Decisive for Mycobacterium tuberculosis Pathology and Bacterial Burden in Mice. PLoS ONE 10(3): e0121070. https://doi.org/10.1371/journal.pone.0121070

Academic Editor: Martin E. Rottenberg, Karolinska Institutet, SWEDEN

Received: September 4, 2014; Accepted: January 27, 2015; Published: March 19, 2015

Copyright: © 2015 Guler et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Data Availability: Data was deposited in the GEO database, www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=gzulosighhunvsf&acc=GSE56736 accession number (GSE56736).

Funding: This work was supported by the International Centre for Genetic Engineering & Biotechnology (ICGEB), Cape Town Component with Arturo Falaschi, Claude Leon Foundation and CIDRI, Wellcome trust (Grant No. 084323) post-doctoral fellowships to SPP. South African Medical Research Council (SAMRC) Unit on DVDFab 11.0.5.6 Crack With License code Free Download 2020 of Infectious Diseases (FB). A National Research Funding (NRF) South Africa and the South African Research Chair initiative (SARChi) to FB, the NRF Competitive Programme for Unrated Researchers (CSUR) and South African Medical Research Council (Self-Initiated Research Grant) to RG, the JST Strategic International Research Cooperative Program to HS and ICGEB Arturo Falaschi PhD Fellowship to MO. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Classical activation of macrophages results in concomitant production of reactive nitrogen intermediates (RNIs) such as nitric oxide (NO), killing intracellular Mtb [1]. In contrast, alternative activation of macrophages is induced by IL-4 or IL-13 via the IL-4 receptor-alpha chain (IL-4Rα) and results in decreased NO production by induction of Arg1, which competes with iNOS for the common substrate L-Arginine [2, 3]. Considering the hostile milieu inside caMph, Mtb uses evasion mechanisms and might potentially subvert the transcriptional network to hide in alternatively activated macrophages, thereby avoiding caMph effector killing functions. Indeed, Mtb has been shown to interfere with polarization of caMph by restricting MyD88-dependent TLR signalling through the secretion of the virulence factor ESAT-6 [4]. Elevated levels of IL-4 was found in patients with progressive pulmonary TB and is related to the presence of pulmonary cavities [5–9]. In vitro infection of PBMC with clinical Beijing strain HN878 resulted in the upregulation of IL-4/IL-13 [10]. Earlier studies reported that TH2 responses and aaMph have been implicated in the re-activation of latent TB in mice [11] and intracellular persistence of Mtb in murine macrophages, [12] respectively. Moreover, Arg1 was induced in HN878-infected murine macrophages [13] and is expressed in lung granulomas of TB patients [14] suggesting possible avoidance of NO mediated killing by the hypervirulent strain of Mtb.

The induction of Arg1 by TH2 cytokines in macrophages is well studied and requires STAT6 signalling through the IL-4Rα chain [2, 15, 16]. However, we have limited information on the induction of Arg1 following mycobacterial infections. Two in vitro studies showed that M. bovis BCG induces Arg1 through a MyD88-dependent pathway but in an STAT6-independent manner [13, 17]. Qualls et al. characterized the pathway involved and revealed that M. bovis BCG-infected macrophages secrete MyD88-dependent IL-6, IL-10 and G-CSF that induces Arg1 expression in an autocrine/paracrine manner [13].

Here we expand on the M. bovis BCG in vitro studies by Qualls et al. and El Kasmi et al. [13, 17] and confirm their findings in vivo using the hypervirulent Beijing strain, Mtb HN878 and LysMcreIL-4Rα-/lox mice, which are deficient for IL-4Rα in macrophages and neutrophils [18]. Even though neutrophils play important roles in the host response to acute tuberculosis, IL-4Rα responsive neutrophils seem not to have essential function in TB pathology [19, 20].

We show that the absence of IL-4Rα responsiveness on macrophages only marginally influenced acute bacterial burden, chronic pulmonary pathology and does not influence survival following infection with virulent and hypervirulent strains of Mtb. Taken together, this suggests that IL-4Rα-activated macrophages are not required for TB disease progression since Mtb induces Arg1 production independent of the IL-4Rα signalling pathway.

Materials and Methods

Mice

Wild-type BALB/c, control littermates (IL-4Rα-/lox), IL-4Rα-/- and macrophage cell-specific IL-4Rα deficient mice (LysMcreIL-4Rα-/lox) on a BALB/c background (8–12 weeks) were kept under specific-pathogen-free conditions in individually ventilated cages.

Ethics Statement

All experiments were performed in accordance with the South African National Standard (SANS 10386:2008) and University of Cape Town of practice for laboratory animal procedures. The protocol (Permit Number: 012/036) was approved by the Animal Ethics Committee, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa. All animal users had successfully completed the mandatory University of Cape Town animal handling courses and accredited by South African Veterinary Council. All procedures were performed under halothane anaesthesia.

Mtb infection in mice

Mice were infected with Mycobacterium tuberculosis H37Rv and HN878 via the intranasal or aerosol route pro tools mac torrent described previously [21]. Body weight of Mtb-infected mice was measured twice a week and mice were monitored daily. If infected mice lost more than 20% of their original body weight or showed severe signs of illness, such as hunched up posture, coat staring, immobility and general lack of grooming, mice were considered moribund and were euthanized to minimize suffering. Lung weight index and bacterial loads in lungs and spleen of Mtb-infected mice were determined at different time points PI (post infection) as previously described [21, 22].

Histopathology and immunohistochemistry

Lungs of Mtb-infected mice were fixed with 4% phosphate-buffered formalin, and 3 μm-thick sections were stained with either H&E or rabbit anti-mouse Ab to iNOS or goat anti-mouse Ab to Arg1 (Abcam). Detection was performed using HRP-labelled anti-rabbit and anti-goat Abs (Dako) respectively. The lung histopathology scores were graded from 0–10 based on perivascular/ peribronchiolar lymphocytic infiltrates, reduced ventilated alveolar spaces and extensive pulmonary lesions.

Analysis of immune cell populations and IL-4Rα expression in lungs by FACS

Single cell suspensions of the lungs were stained as previously described [23–25]. Briefly, lung cells were subjected to staining with rat anti-mouse IL-4Rα PE (BD Biosciences) and rat anti-mouse antibodies for various markers of T cells/B cells/Mph/DCs/Neutrophils & Eosinophils (BD Biosciences) with blocking 1% rat serum and 1% anti-FcyRII/III. Cells were acquired using FACS Calibur (BD Biosciences) and analysed by FlowJo (TreeStar).

Co-culture

CD4+ T cells from wild type (BALB/c) naive splenocytes (>94% purity) were sorted using MACS beads (Miltenyi Biotec) and labelled with Oregon green (Invitrogen), then cultured with CD11c-sorted macrophages isolated from the lung tissue of naïve non-infected or Mtb-infected mice. Co-cultured cells were collected after 4 days for CD4+ T cell staining and analysed for T cell proliferation using flow cytometry.

Generation of BMDM and Mtb in vitro infection

BMDM were generated as previously described [26]. 5x106 BMDM/well were treated with or without: 100 U/ml IL-4 and 100 U/ml IL-13 (BD Biosciences). After 24 hours, cells were washed twice with antibiotic-free media and the BMDM were infected in antibiotic-free medium with live logarithmic phase Mtb HN878 at a MOI 5:1 (bacilli:macrophage) in the presence or absence of activators. After 4 h of infection, BMDM were washed once with culture media and incubated with plus/minus activators, 10 μg/ml of gentamicin, 100 U/ml penicillin G and 100 μg/ml streptomycin. At 4, 12 and 48h PI, BMDM were lyzed with 1 ml of Qiazol and total RNA was extracted by miRNAeasy kit (Qiagen).

Microarray

Total RNA (500 ng) was amplified using the Ambion total RNA amplification kit (Ambion) and was hybridized to Illumina mouse Sentrix bead chips WG-6V2 array (Illumina). Scanning of the chip was performed using Illumina BeadScan and data was generated using BeadStudio software packages (version 1.6). Two biological replicates were analysed and the data was deposited in the GEO database (GSE56736).

Gene Set Enrichment Analysis

Genes were extracted from both Pathway Commons database [27] and National Cancer Institute Pathway Interaction Database [28]. The GSEA v2.0.13 tool [29] was used to conduct enrichment analysis. Multiple probes corresponding to the same gene were first collapsed by taking mean value of each probe set. Genes were then pre-ranked by using the metric score of log2 fold-changes. Normalized enrichment scores (NES), nominal p-values and false discovery rates (FDR) were computed by permuting sample labels 1000 times as previously described [29]. GenePattern [30] software was used for the generation of heatmaps of leading edge genes.

Statistics

Data is represented as mean values ± SEM. Statistical analysis was performed using Student’s t test, two-tailed, unequal variance, defining differences to control groups as significant (*, P < 0.05; **, P < 0.01; ***, P < 0.001).

Results

IL-4Rα responsive macrophages contribute to containing early bacterial burden and chronic pulmonary inflammation

Wild-type (BALB/c), IL-4Rα-/- and IL-4Rα macrophage cell-specific deficient mice (LysMcreIL-4Rα-/lox) were infected via pulmonary aerosol route with 100 CFU/mouse of Mtb, H37Rv. All mice gradually increased in weight (Fig. 1A). The bacillary burden at 4 weeks after infection was significantly increased in macrophage cell-specific IL-4Rα deficient mice when compared to wild-type mice (Fig. 1B). However, in terms of biological significance this CFU increase was only marginal with a ½ log increase. In contrast, no significant difference was observed in bacillary burden in the lungs and spleens between all the groups at 18 weeks PI. The lung weight index, a surrogate indicator of inflammation, did not reveal any differences between the groups during the infection (Fig. 1C). At 4 and 18 weeks PI all mouse groups displayed similar well-defined granuloma formation (Fig. 1D). However, the histopathology score, as described in the Materials and Methods, at 18 weeks PI revealed significantly increased inflammation in macrophage cell-specific IL-4Rα deficient mice, when compared to wild-type BALB/c mice (Fig. 1E). Pulmonary histopathology, bacterial burden, iNOS and Arg1 expression were similar between wild-type BALB/c and IL-4Rα-/- mice (S1 Fig.). These results suggest that IL-4Rα responsive macrophages contribute to containing bacterial growth during the acute phase and down-modulate inflammation during the chronic phase of Mtb infection.

thumbnail
Download:

Fig 1. Increased acute bacterial burden and chronic pulmonary pathology in absence of IL-4Rα responsive macrophages following low-dose Mtb H37Rv infection

. Wild-type (BALB/c), IL-4Rα-/- and IL-4Rα macrophage cell-specific deficient mice (LysMcreIL-4Rα-/lox) were infected with Mtb H37Rv (100 CFU/mouse) by aerosol (n = 12–13 mice/group). (A) Percentages in body weight change are shown. (B) Mice were sacrificed at 4 and 18 weeks PI to determine bacterial loads in the lungs and spleen. (C) Lung weight indexes are shown. (D) At 0, 4 and 18 weeks PI, formalin-fixed lung sections were stained with H&E. Original magnification: 40X. (E) Lung sections of 5 mice per group were evaluated for pulmonary histopathology flowjo alternatives - Free Activators and quantification of total lesion sizes. N.D. = not detectable. (F) IL-4Rα expression was measured by flow cytometry on alveolar macrophages (SiglecF+CD11c+) at 0 and 18 weeks PI (*P < 0.05, **P < 0.01). Data shown are representative (A, D, E and F) and pooled (B, C) from two independent experiments.

https://doi.org/10.1371/journal.pone.0121070.g001

Reduced IL-4Rα expression on alveolar macrophages in LysMcreIL-4Rα-/lox mice following Mtb infection

We previously showed that macrophage-specific IL-4Rα expression was impaired in OVA-challenged lungs, [23] and in mesenteric lymph nodes [18] and liver granulomas [31] from S. mansoni infected LysMcreIL-4Rα-/lox mice. Here we characterized the IL-4Rα expression by flow cytometry in the lungs during low dose H37Rv infection (Fig. 1F). The results showed that the IL-4Rα expression is genetically abrogated in alveolar macrophages in LysMcreIL-4Rα-/lox when compared to BALB/c wild-type mice at 18 weeks PI.

IL-4Rα deficient macrophages show similar iNOS and Arg1 expression during low dose Mtb infection

Numerous studies in allergic airway and parasitic diseases have reported that the classical caMph marker iNOS is increased and the typical aaMph marker Arg1 is decreased in macrophage cell-specific IL-4Rα deficient mice when compared to control groups [18, 23, 31, 32]. In contrast, our immunohistochemistry results show that LysMcreIL-4Rα-/lox mice had comparable levels of iNOS and Arg1 (Fig. 2A) when compared to wild-type mice during acute/chronic phase of infection with low-dose Mtb H37Rv (100 CFU/mouse). Interestingly, Arg1 was not yet expressed in the lungs of mice at the 4 week time point, suggesting that induction occurs later during the course of disease. Finally, iNOS and Arg1 Mirillis Action Crack 4.18.1 [Keygen/Keys 2021] Download (Fig. 2B) was further confirmed at 18 weeks PI by flow cytometry in alveolar macrophages (CD11chighCD11blow), conventional dendritic cells (CD11chighCD11bhigh), recruited interstitial macrophages (CD11clowCD11bmid) and monocytes (CD11c-CD11blow) using cell surface markers as previously defined [24, 25]. Gating strategy is shown in S2 Fig. Together, these data demonstrate that Arg1 is induced through an IL-4Rα-independent pathway and is only expressed after a well-established Mycobacterium infection in macrophage cell-specific IL-4Rα deficient mice.

thumbnail
Download:

Fig 2. No major differences in expression of iNOS, Arg1, lung immune cell populations and T cell proliferation between wild-type and macrophage cell-specific IL-4Rα deficient mice following low-dose Mtb H37Rv infection (100 CFU/mouse).

(A) iNOS and Arg1 staining (brown colour) from lung sections collected at indicated times PI, original magnification: 40X. Lung sections from 5 mice/group were quantified. N.D. = not detectable. (B) iNOS and Arg1 expression on various immune cells were analysed by flow cytometry at 18 weeks PI (6–7 mice/group, *P < 0.05). (C) T cell proliferation with co-cultured CD11c-sorted macrophages from the lung tissue of naïve non-infected and mice infected with H37Rv (100 CFU/mouse) by aerosol at 4 and 18 weeks. Data shown in A is representative of two independent experiments and results obtained in B and C are from one experiment.

softmaker office 2018 crack https://doi.org/10.1371/journal.pone.0121070.g002

Similar T cell proliferation in the absence of IL-4Rα-dependent macrophages during low dose Mtb infection

It has been reported that IL-4 exposed macrophages suppress proliferation of T cells via a STAT6-dependent pathway [33]. We co-cultured Oregon Green-labelled CD4+ T cells with macrophages isolated from naïve and Mtb-infected LysMcreIL-4Rα-/lox mice and their corresponding wild-type mice (Fig. 2C). Absence of IL-4Rα responsive macrophages did not influence the proliferative activity on T cells. In conclusion, these results indicate that the IL-4Rα expression on macrophages is not required to alter cellular lung composition and T cell proliferation during Mtb infection.

Deletion of IL-4Rα on macrophages does not influence survival or pathology after high dose Mtb H37RV infection

To determine the absence of macrophage IL-4Rα signalling on the susceptibility to high dose Mtb infection, wild-type (BALB/c) and IL-4Rα macrophage cell-specific deficient mice (LysMcreIL-4Rα-/lox) were infected intranasally with 104 CFU/mouse of H37Rv (Fig. 3A). A high infectious dose resulted in rapid death within 8 weeks of infection and the remaining mice progressively lost weight and died within the 8 months of the monitoring period. Kaplan-Meier analysis did not reveal any significant difference (P = 0.729) in survival between both groups of mice. Lung bacterial burden and Mtb dissemination to the spleen (Fig. 3B), iNOS and Arg1 expression (Fig. 3C) and T cell proliferation (Fig. 3D) from Mtb-infected LysMcreIL-4Rα-/lox and BALB/c mice were similar. Taken together, these data demonstrate that the absence of IL-4Rα-dependent macrophages did not influence the survival and immune response to high dose TriDef 3D 7.5 Crack + Activation Key 2021 - Free Activators with H37Rv.

thumbnail
Download:

Fig 3. Similar mortality, inflammation, bacterial burden, Arg1/iNOS expression and T cell proliferation in wild-type and LysMcreIL-4Rα-/lox mice following high dose infection with Mtb H37Rv

. Wild-type (BALB/c) and IL-4Rα macrophage cell-specific deficient mice (LysMcreIL-4Rα-/lox) were infected intranasally with high dose of 104 CFU/mouse of Mtb H37Rv (n = 20/group). (A) Survival of infected mice was recorded weekly. (B) Individual bacterial titers (CFU/organ) with group medians are shown (*P < 0.05). (C) iNOS and Arg1 staining (brown colour) from lung sections collected at 3 and 10 weeks PI. Lung sections from 5 mice/group were quantified. Original magnification: 40X. N.D. = not detectable. (D) T cell proliferation with co-cultured CD11c-sorted macrophages from the lung tissue of naïve non-infected and 3 weeks infected mice. All data shown is representative of two independent experiments except for B which is representative of three independent experiments.

https://doi.org/10.1371/journal.pone.0121070.g003

Deletion of IL-4Rα on macrophages does not influence survival and innate immunity to a hypervirulent strain of Mtb (HN878)

To assess whether IL-4Rα responsive macrophages play a role in the susceptibility to a hypervirulent strain of Mtb, LysMcreIL-4Rα-/lox and wild-type BALB/c mice were infected with clinical isolate strain HN878 of Mtb. Here we show that LysMcreIL-4Rα-/lox had similar high mortality rates (Fig. 4A) and mycobacterial burden (Fig. 4B) in the lungs and spleen when compared to BALB/c wild-type mice. Kaplan-Meier analysis did not reveal any significant difference (P = 0.621) in survival between both groups of mice. Lung weight index and histopathology scores of H&E stained lung sections did not reveal any significant differences among the HN878-infected groups (Fig. 4C and 4D). iNOS and Arg1 expression were similar between both groups of mice when analysed at 3 weeks PI (Fig. 4E). Moreover, T cell proliferation was not altered in the presence of macrophages isolated from the different infected groups (Fig. 4F). Together, these results illustrated that IL-4Rα responsive macrophages do not influence survival and innate protective immunity against the hypervirulent strain HN878 of Mtb.

thumbnail
Download:

Fig 4. Macrophage cell-specific IL-4Rα deficient and wild-type mice displayed similar mortality, inflammation and T cell proliferation to hypervirulent Mtb HN878 infection

. Wild-type (BALB/c) and IL-4Rα macrophage cell-specific deficient mice (LysMcreIL-4Rα-/lox) were infected intranasally with 500 CFU/mouse of hypervirulent Mtb HN878. (A) Survival of infected mice was recorded weekly (n = 6–8/group). (B) Individual bacterial titers (CFU/organ), (C) lung weight indexes and (D) histopathology score with group medians are shown at 3 weeks PI (n = 11/group). (E) iNOS and Arg1 staining (brown colour) from lung sections collected at 3 weeks PI. Lung sections from 5 mice/group were quantified. Original magnification: 40X. N.D. = not detectable. (F) T cell proliferation with co-cultured CD11c-sorted macrophages from the lung tissue of naïve non-infected and mice infected with HN878 at 3 weeks PI. Data shown in A-E is representative of two independent experiments and results obtained in F is from one experiment.

https://doi.org/10.1371/journal.pone.0121070.g004

The MyD88 but not IL-4Rα dependent pathway is enriched in HN878-infected macrophages

We employed gene set enrichment analysis (GSEA) on genome-wide gene expression data to determine whether IL-4Rα signalling pathway genes or MyD88-mediated pathway genes associated with Arg1 expression were enriched during Mtb infection. Expression WinToHDD Licenses key of BMDM infected with HN878 Mtb were analysed, and GSEA was performed with gene sets for IL-6, IL-10 and G-CSF (CSF3) pathways, MyD88-mediated pathways and the IL-4Rα pathway. GSEA revealed that genes scriptcase download - Free Activators the MyD88-mediated pathways (P = 0.019) and IL-6, IL-10 and G-CSF cytokine pathways (P = 0.033) are highly enriched during HN878 infection when compared to non-infected samples (Fig. 5A and 5B). However, genes in the IL-4Rα pathway are not significantly enriched during Mtb infection when compared to non-infected samples with a p-value of 0.07 (Fig. 5C). Collectively, these results indicate that Arg1 may be induced by a MyD88-dependent cell extrinsic pathway rather than an IL-4Rα dependent pathway during Mtb infection by the hypervirulent strain HN878.

thumbnail
Download:

Fig 5. MyD88 and IL-6, IL-10, G-CSF-dependent pathway genes are significantly enriched in HN878 infected vs. non-infected macrophages

. BMDM were stimulated with IL-4/IL-13 or left untreated. After 24 hours of stimulation, cells were infected with HN878. Total RNA was extracted at 4, 12 and 48 hours PI for microarray and GSEA analysis. Enrichment plots and heat maps for (A) MyD88, (B) IL-6, IL-10, G-CSF and (C) IL-4Rα pathway are shown. Enrichment analysis compared log2-fold changes in Mtb-infected samples vs. non-infected samples. The rows in heat maps are listed according to pre-ranking metric scores. Replicates shown are from two independent experiments.

https://doi.org/10.1371/journal.pone.0121070.g005

Discussion

AaMph are activated by IL-4/IL-13 to induce Arg1, subverting the host NO-based mycobactericidal activity. This suggests that induction of Arg1 is an important evasion tactic exploited by Mtb to thrive inside caMph. Indeed, specific depletion of Arg1 in macrophages using the Cre-LoxP recombination system resulted in elevated NO levels that contributed to 1-log reduction in lung colony counts following Mtb H37Rv infection [17]. In aaMph, Arg1 is induced by IL-4/IL-13 via the IL-4Rα chain. Thus, deleting the IL-4Rα signalling pathway would lead to increased availability of L-Arginine substrate for iNOS, leading to enhanced NO-mediated killing functions. Indeed, using the Cre-LoxP system, we have previously shown that when IL-4Rα is specifically deleted Bandicam Crack 5.2.1.1860 + Serial Number Free Download 2021 macrophage cells, Arg1 activity is reduced and NO production is increased. This leads to enhanced killing of L. major parasites [32] and results in protective immunity against N. brasiliensis [18]. Previously, it was not known whether the absence of IL-4Rα during mycobacterial infection influences Arg1 and NO expression, and may therefore alter susceptibility to Mtb. Therefore, we investigated the role of IL-4Rα-activated alternative macrophages during Mtb infection using LysMcreIL-4Rα-/lox mice, where the IL-4Rα allele is flanked by loxP sites and the Cre recombinase is under the control of the lysozyme M gene (LysMcre), thus restricting Cre-mediated excision of IL-4Rα in macrophages and neutrophils. Although the deletion efficiency of IL-4Rα in mature macrophages is not 100%, [34] we observed similar IL-4Rα deletion between LysMcreIL-4Rα-/lox and IL-4Rα-/- mice during Mtb infection (Fig. 1F). Previously we found that Th1/Th2 polarization and lymphocyte proliferation was not altered in LysMcreIL-4Rα-/lox when compared to WT BALB/c mice [18].

Interestingly, we found similarly high induction of both iNOS and Arg1 in IL-4Rα-/- (S1 Fig.), LysMcreIL-4Rα-/lox and WT BALB/c mice. Expression of iNOS and Arg1 was consistently detected during the acute and chronic phases of infection with low and high doses of the virulent laboratory strain H37Rv, and also using the hypervirulent clinical isolate HN878. These results suggest that Arg1 expression in macrophages is induced via an IL-4Rα-independent pathway. Moreover, the absence of IL-4Rα on macrophages did not influence the susceptibility, mortality and pathology to virulent H37Rv, clinical CDC1551 (data not shown), and HN878 Mtb strains. In addition, lung bacterial burdens, Mtb (H37Rv) dissemination to spleen, and histopathology were similar between IL-4Rα-/- (S1 Fig.), LysMcreIL-4Rα-/lox and wild-type BALB/c mice. However, we did observe a significant increase in early lung bacterial loads and chronic histopathology scores in LysMcreIL-4Rα-/lox when compared to wild-type BALB/c mice following low dose infection with H37Rv, although the differences were marginal. Bacterial burden, susceptibility, histopathology, Arg1 and iNOS expression and were similar between control littermates (IL-4Rα-/lox) and wild-type BALB/c mice infected with Mtb H37Rv and HN878 (data not shown).

Huber et al. reported that IL-4-exposed macrophages suppress T cell proliferation in a STAT6-dependent manner [33]. In contrast to Huber et al., our results revealed that T cell proliferation was not affected by the presence or absence of IL-4Rα on macrophages during Mtb infection with both virulent and hypervirulent strains. These differences could be attributed to IL-4Rα-independent production of Arg1 which is sufficient to suppress T cell proliferation in aaMph [35]. Similarly to our study, Arg1+ alveolar macrophages were observed in LysMcreIL-4Rα-/lox mice during a pulmonary infection with C. neoformans [36]. The Zoom Player Max Keygen that in our hands LysMcreIL-4Rα-/lox mice produced an equal amount of Arg1 when compared to wild-type BALB/c mice suggests that Mtb is responsible for driving Arg1 expression independently of the IL-4Rα signalling pathway. Indeed, Qualls et al. and El Kasmi et al. found in vitro that M. bovis BCG induces the expression of Arg1 in a manner that is dependent on MyD88 [13, 17]. This was demonstrated by the fact that M. bovis BCG infected MyD88 deficient macrophages, which displayed a lack of Arg1 expression, whereas Arg1 was induced in STAT6-/- macrophages. Our study expands on their observations, as we show that in macrophages infected with the hypervirulent clinical isolate HN878 strain of Mtb, genes in the MyD88-dependent pathway are enriched for high expression as compared to the genes in the IL-4Rα-dependent pathway. We also found that the IL-6, IL-10 and G-CSF pathways are enriched during HN878 infection, in accordance with the findings of Qualls et al., who reported that these cytokines can act in an autocrine-paracrine manner to induce Arg1 via STAT3 phosphorylation during M. bovis BCG infection [13].

In addition, we investigated the in vivo involvement of IL-4Rα in the production of Arg1. We found that IL-4Rα-dependent alternative activation of macrophages is not decisive in the control of susceptibility and pathology to both virulent and hypervirulent strains of Mtb. Importantly, Mtb induces Arg1 but in an IL-4Rα-independent manner. We further show that virulent and clinical Mtb strains can induce Arg1 expression, potentially thriving in aaMph to establish persistence and survival.

Supporting Information

S1 Fig. No major differences in pulmonary histopathology, iNOS, Arg1 and bacterial burden between wild-type and IL-4Rα deficient mice following low-dose Mtb, H37Rv infection (100 CFU/mouse).

(A) H&E, iNOS and Arg1 staining from lung sections collected at 0 and 18 wks post infection, original magnification: 40X. (B) Histopathology score, quantification of lesion sizes, iNOS and Arg1 quantification. N.D. = not detectable. (C) Lung weight indexes and bacterial burden in the lungs and spleen are shown (5 mice/group, *P < 0.05). All data shown is representative of two independent experiments.

https://doi.org/10.1371/journal.pone.0121070.s001

(TIF)

S2 Fig. Representative gating strategy with forward and side scatter to eliminate debris.

CD11b and CD11c-expressing subsets in the lung were defined as R1: conventional dendritic cells (CD11chighCD11bhigh), R2: alveolar macrophages (CD11chighCD11blow), R3: recruited interstitial macrophages (CD11clowCD11bmid) and R4: monocytes (CD11c-CD11blow).

https://doi.org/10.1371/journal.pone.0121070.s002

(TIF)

Acknowledgments

We thank the UCT Animal Unit and Wendy Green, Rayaana Fredericks and Nazila Ghodsi for maintaining and genotyping mice. We thank Fadwah Booley, Faried Abbass, Rodney Lucas, Hylton Bunting for their valuable technical assistance. We are grateful to Lizette Fick, Marilyn Tyler, Zoë Lotz and Amy Booth for their excellent histology services.

Author Contributions

Conceived and designed the experiments: RG SPP S. Savvi AS FB. Performed the experiments: RG SPP S. Savvi EL AS SR NEN. Analyzed the data: RG SPP S. Savvi EL AS SR NEN MO S. Schmeier. Contributed reagents/materials/analysis tools: RG HS FB. Wrote the paper: RG SPP.

References

  1. 1. Benoit M, Desnues B, Mege ANSYS Motion 2021 R2 Crack Download [Latest Version]. Macrophage polarization in bacterial infections. J Immunol. 2008 Sep 15;181(6):3733–9. pmid:18768823
  2. 2. Martinez FO, Helming L, Gordon S. Alternative activation of macrophages: an immunologic functional perspective. Annu Rev Immunol. 2009;27:451–83. pmid:19105661
  3. 3. Gordon S. Alternative activation of macrophages. Nat Rev Immunol. 2003 Jan;3(1):23–35. pmid:12511873
  4. 4. Pathak SK, Basu S, Basu KK, Banerjee A, Pathak S, Bhattacharyya A, et al. Direct extracellular interaction between the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2 inhibits TLR signaling in macrophages. Nat Immunol. 2007 Jun;8(6):610–8. pmid:17486091 swiftshader_dx9_sm3_build_3383 x86.rar download. Ashenafi S, Aderaye G, Bekele A, Zewdie M, Aseffa G, Hoang AT, et al. Progression of clinical tuberculosis is associated with a Th2 immune response signature in combination with elevated levels of SOCS3. Clin Immunol. 2014 Apr;151(2):84–99. pmid:24584041
  5. 6. Nolan A, Fajardo E, Huie ML, Condos R, Pooran A, Dawson R, et al. Increased production of IL-4 and IL-12p40 from bronchoalveolar lavage cells are biomarkers of Mycobacterium tuberculosis in the sputum. PLoS One. 2013;8(3):e59461. pmid:23527200
  6. 7. Ordway DJ, Costa L, Martins M, Silveira H, Amaral L, Arroz MJ, et al. Increased Interleukin-4 production by CD8 and gammadelta T cells in health-care workers is associated with the subsequent development of active tuberculosis. J Infect Dis. 2004 Aug 15;190(4):756–66. pmid:15272404
  7. 8. van Crevel R, Karyadi E, Preyers F, Leenders M, Kullberg BJ, Nelwan RH, et al. Increased production of interleukin 4 by CD4+ and CD8+ T cells from patients with tuberculosis is related to the presence of pulmonary cavities. J Infect Dis. 2000 Mar;181(3):1194–7. pmid:10720554
  8. 9. Dheda K, Chang JS, Huggett JF, Kim LU, Johnson MA, Zumla A, et al. The stability of mRNA encoding IL-4 is increased in pulmonary tuberculosis, while stability of mRNA encoding the antagonistic splice variant, IL-4delta2, is not. Tuberculosis (Edinb). 2007 May;87(3):237–41. pmid:17196882
  9. 10. Manca C, Reed MB, Freeman S, Mathema B, Kreiswirth B, Barry CE 3rd, et al. Differential monocyte activation underlies strain-specific Mycobacterium tuberculosis pathogenesis. Infect Immun. 2004 Sep;72(9):5511–4. pmid:15322056
  10. 11. Howard AD, Zwilling BS. Reactivation of tuberculosis is associated with a shift from type 1 to type 2 cytokines. Clin Exp Immunol. 1999 Mar;115(3):428–34. pmid:10193414
  11. 12. Kahnert A, Seiler P, Stein M, Bandermann S, Hahnke K, Mollenkopf H, et al. Alternative activation deprives macrophages of a coordinated defense program to Mycobacterium tuberculosis. Eur J Immunol. 2006 Mar;36(3):631–47. pmid:16479545
  12. 13. Qualls JE, Neale G, Smith AM, Koo MS, DeFreitas AA, Zhang H, et al. Arginine usage in mycobacteria-infected macrophages depends on autocrine-paracrine cytokine signaling. Sci Signal. 2010;3(135):ra62. pmid:20716764
  13. 14. Pessanha AP, Martins RA, Mattos-Guaraldi AL, Vianna A, Moreira LO. Arginase-1 expression in granulomas of tuberculosis patients. FEMS Immunol Med Microbiol. 2012 Nov;66(2):265–8. pmid:22827286
  14. 15. Pauleau AL, Rutschman R, Lang R, Pernis A, Watowich SS, Murray PJ. Enhancer-mediated control of macrophage-specific arginase I expression. J Immunol. 2004 Jun 15;172(12):7565–73. pmid:15187136
  15. 16. Gray MJ, Poljakovic M, Kepka-Lenhart D, Morris SM Jr. Induction of arginase I transcription by IL-4 requires a composite DNA response element for STAT6 and C/EBPbeta. Gene. 2005 Jun 20;353(1):98–106. pmid:15922518
  16. 17. El Kasmi KC, Qualls JE, Pesce JT, Smith AM, Thompson RW, Henao-Tamayo M, et al. Toll-like receptor-induced arginase 1 in macrophages thwarts effective immunity against intracellular pathogens. Nat Immunol. 2008 Dec;9(12):1399–406. pmid:18978793
  17. 18. Herbert DR, Holscher C, Mohrs M, Arendse B, Schwegmann A, Radwanska M, et al. Alternative macrophage activation is essential for survival during schistosomiasis and downmodulates T helper 1 responses and immunopathology. Immunity. 2004 May;20(5):623–35. pmid:15142530
  18. 19. O'Garra A, Redford PS, McNab FW, Bloom CI, Wilkinson RJ, Berry MP. The immune response in tuberculosis. Annu Rev Immunol. 2013;31:475–527. pmid:23516984
  19. 20. Lowe DM, Redford PS, Wilkinson RJ, O'Garra A, Martineau AR. Neutrophils in tuberculosis: friend or foe? Trends Immunol. 2012 Jan;33(1):14–25. pmid:22094048
  20. 21. Guler R, Parihar SP, Spohn G, Johansen P, Brombacher F, Bachmann MF. Blocking IL-1alpha but not IL-1beta increases susceptibility to chronic Mycobacterium tuberculosis infection in mice. Vaccine. 2011 Feb 1;29(6):1339–46. pmid:21093494
  21. 22. Welsh KJ, Abbott AN, Hwang SA, Indrigo J, Armitige LY, Blackburn MR, et McAfee Safe Family License key. A role for tumour necrosis factor-alpha, complement C5 and interleukin-6 in the initiation and development of the mycobacterial cord factor trehalose 6,6'-dimycolate induced granulomatous response. Microbiology. 2008 Jun;154(Pt 6):1813–24. pmid:18524936
  22. 23. Nieuwenhuizen NE, Kirstein F, Jayakumar J, Emedi B, Hurdayal R, Horsnell WG, et al. Allergic airway disease is unaffected by the absence of IL-4Ralpha-dependent alternatively activated macrophages. J Allergy Clin Immunol. 2012 Sep;130(3):743–50 e8. pmid:22552110
  23. 24. Gonzalez-Juarrero M, Shim TS, Kipnis A, Junqueira-Kipnis AP, Orme IM. Dynamics of macrophage cell populations during murine pulmonary tuberculosis. J Immunol. 2003 Sep 15;171(6):3128–35. pmid:12960339
  24. 25. Wolf AJ, Linas B, Trevejo-Nunez GJ, Kincaid E, Tamura T, Takatsu K, et al. Mycobacterium tuberculosis infects dendritic cells with high frequency and impairs their function in vivo. J Immunol. 2007 Aug 15;179(4):2509–19. pmid:17675513
  25. 26. Schwegmann A, Guler R, Cutler AJ, Arendse B, Horsnell WG, Flemming A, et al. Protein kinase C delta is essential for optimal macrophage-mediated phagosomal containment of Listeria monocytogenes. Proc Natl Acad Sci U S A. 2007 Oct 9;104(41):16251–6. pmid:17913887
  26. 27. Cerami EG, Gross BE, Demir E, Rodchenkov I, Babur O, Anwar N, et al. Pathway Commons, a web resource for biological pathway data. Nucleic Acids Res. 2011 Jan;39(Database issue):D685–90. pmid:21071392
  27. 28. Schaefer CF, Anthony K, Krupa S, Buchoff J, Day M, Hannay T, et al. PID: the Pathway Interaction Database. Nucleic Acids Res. 2009 Jan;37(Database issue):D674–9. pmid:18832364
  28. 29. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005 Oct 25;102(43):15545–50. pmid:16199517
  29. 30. Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, Mesirov JP. GenePattern 2.0. Nat Genet. 2006 May;38(5):500–1. pmid:16642009
  30. 31. Dewals BG, Marillier RG, Hoving JC, Leeto M, Schwegmann A, Brombacher F. IL-4Ralpha-independent expression of mannose receptor and Ym1 by macrophages depends on their IL-10 responsiveness. PLoS Negl Trop Dis. 2010;4(5):e689. pmid:20502521
  31. 32. Holscher C, Arendse B, Schwegmann A, Myburgh E, Brombacher F. Impairment of alternative macrophage activation delays cutaneous leishmaniasis in nonhealing BALB/c mice. J Immunol. 2006 Jan 15;176(2):1115–21. pmid:16394000
  32. 33. Huber S, Hoffmann R, Muskens F, Voehringer D. Alternatively activated macrophages inhibit T-cell proliferation by Stat6-dependent expression of PD-L2. Blood. 2010 Oct 28;116(17):3311–20. pmid:20625006
  33. 34. Clausen BE, Burkhardt C, Reith W, Renkawitz R, Forster I. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 1999 Aug;8(4):265–77. pmid:10621974
  34. 35. Pesce JT, Ramalingam TR, Mentink-Kane MM, Wilson MS, El Kasmi KC, Smith AM, et al. Arginase-1-expressing macrophages suppress Th2 cytokine-driven inflammation and fibrosis. PLoS Pathog. 2009 Apr;5(4):e1000371. pmid:19360123
  35. 36. Muller U, Stenzel W, Piehler D, Grahnert A, Protschka M, Kohler G, et al. Abrogation of IL-4 receptor-alpha-dependent alternatively activated macrophages is sufficient to confer resistance against pulmonary cryptococcosis despite an ongoing T(h)2 response. Int Immunol. 2013 Aug;25(8):459–70. pmid:23532373
Check for updates via CrossMark

Subject Areas

?

For more information about PLOS Subject Areas, click here.

We want your feedback.Do these Subject Areas make sense for this article? Click the target next to the incorrect Subject Area and let us know. Thanks for your help!

  • Macrophages 
  • Mycobacterium tuberculosis 
  • T cells 
  • Histopathology 
  • Alveolar macrophages 
  • Body weight 
  • Mycobacterium bovis 
  • Tuberculosis 
Источник: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0121070
flowjo alternatives  - Free Activators

Notice: Undefined variable: z_bot in /sites/kadinca.us/free-activators/flowjo-alternatives-free-activators.php on line 107

Notice: Undefined variable: z_empty in /sites/kadinca.us/free-activators/flowjo-alternatives-free-activators.php on line 107

4 Replies to “Flowjo alternatives - Free Activators”

Leave a Reply

Your email address will not be published. Required fields are marked *